%PDF-1.4 % 3 0 obj <> /Contents 4 0 R>> endobj 4 0 obj <> stream xRN1\ZŔPd(# .$ D %El. )(<^#c 5\ar,U|OD%SʇSb2;1\JR*uXuce/}U)Ff;c9$t)k#]ܚm!G߭㓎99-m?Uq6[S p[՛'vfKl%U lC{% I'9g9=Әh eg.@M%ygB"N#K{PܜH'EBw2򩜿VYx:: O~{ endstream endobj 5 0 obj <> /Contents 6 0 R>> endobj 6 0 obj <> stream xXoE*H xϏ]L,D, s!9g,,3("d#Q K^|^ߛfG$hLLǔJuFţU)XbTB6]O*U Eq3'FPgVi!Zߵ&;'IƮKsn4#_sIk;Mh/BN'HqV cG?a\ٶ\#IcDo251])/ev4EPaz^~OO}>=dt6PTulڄTPkfojy9vyIɕ1k25<D̄w2È}e_e-7#x}V+oYm'`*r^oy">Bɍ̠ؠiӝ>=QVTo:[%n.tb}~J\=5p|cL3 hwKlV]1}Sb*ClLkWb1XȗXXԅh xbBn/*y*8Ί==a)r=uIQ謤'7k]7k]'-՝;}Y\pԅ) OnZƱ Å!v]BqR*&lhb=zo㴐ptaq"Ac{)oe`+UA0v`kM됈1f7=">/DW!g^'g0=w?[Ihli5+8|奥3,8X$,"z(^zse.&gTCOഡ%W<@4yR_@y΅M#1,`. A0KIܪcJpG~bX'b. 4[A\JGz24譨tRTx* O=E8NR!2_6 2CfyѥYD35ĔKCg>l~ qי0XrW_g+*Juqڒ!oo]EA(Yҏ̒=`?桱Ɂ&x& k Jvԋ><^ˎx>t_ Z.6Gjg&^9}7劏L:; [VWP8%׫2-x&ǖL{kFߊSbFB|* %r/ȌT+qUS39fa> /Contents 8 0 R>> endobj 8 0 obj <> stream xSKN@ zN`L&3-*@,*Fj p .p|hhCd)<Б/@FQ(1?zʬtN H [Be F m!aq ٌ 8',dXq8=Xsrz:y_i5^ˀ1:Y+@eC`u _6-<6]آh@Cz[֣s4;Jw焽#%ciBe]wZFVNY4rn?"]S_EFyX]/nIqM u+lxFy}'% endstream endobj 9 0 obj <> /Contents 10 0 R>> endobj 10 0 obj <> stream xP=O@ e_F9+**"1 FB)(a$\ $ gāL@pā"H@-W(i@QZ}'rBjѠЎM$X~#[:/.|(=yTr.k7zZݨJ{]!&z$ng?iNݔk2OL^vBѡg(d?݄^:+$ZP ryb٣zI' endstream endobj 1 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> stream /CIDInit /ProcSet findresource begin 12 dict begin begincmap /CIDSystemInfo <> def /CMapName /Adobe-Identity-UCS def /CMapType 2 def 1 begincodespacerange <0000> endcodespacerange 1 beginbfrange <0000> <0000> endbfrange endcmap CMapName currentdict /CMap defineresource pop end end endstream endobj 15 0 obj <> endobj 16 0 obj < >> /FontFile2 18 0 R >> endobj 17 0 obj <> stream xRE; bݨ``wb ,?̜^к7Ԇ6 mk{#v6ޮvk:ء7ё&hx':Ltg:۹w]rWڵ7׍nvݝv=qOzڳuozۻ}s_ڷ-+=Ϫ34`m7V endstream endobj 18 0 obj <> stream x| \T9;03")n0&Kj ̰(043`h.f.X*&[fff,3K33{ϐ9;̠3^so0#h"(3)5C0#\مbҲB8Km o!!iNqnýJ' $=ڒk#7x!=s rj By&-:X=sp;ڼqO YώPeAb BAFW  g#4haj A֋-n>!aR JN}'鈻(yTT3HL`t+g3?]ߣߘh- 𚆇GzOq+d;PFIHtG`D^` _!ZPkt7jڢv=RP ꀂPG:Ψ EPBQ@=Q8"PoEP4 D3 AQ(Q bQxQJF#P JEi(eh :ExDh:7Q5Z.u4|\璀~ih'p?7Dq"ϋGQ*3E+' ~m뻠=4WNbst%Ph#a3.LR`tU G| {BDb|:Y$MF rC(DV0q,#*t9hemIw8]FӁrڨۣs *LcUQCX09Af1 pW=\]$fjtAto3N!$A9d>pVۢn0ܦI)hځ T>UعZd.Nj(_]{ v$(ۅ8#F)GvVvS^eʞQbiv$}ͭ21ۥ`]S~"ަݙ ,N!: 䪴ƐZ%+>޷nͯluepxQ86C(8?'܇{nߧZR*?LWa}T k9,>A9[4@ CzTp.z$?_A-/naCK0ܞd,uܓxP< ǒ9tG x-5T+i^î8eyg%=Ft~E@@8p+PѫwpIvOF|{@+a`zv3&ßI}ͣo/4.tsp$Ƈ;nxv_ߋۼxoHӃv~@ Ȟ^FedI>EcFA.4՟Y Z< A^ :px@s`&C'u>8tY&0zt/ZisO G%&#^R{=?_^^Ixr˗Ϝ|{G<>w:.w>;Z {{{[ nA}#z ˖̛;wޒI:_ϟo}a$t7^-x:w}$`M_Qq/E_rpxYG<\v$[GpwpD ESDIW *㫒h?Vm?&t|/G>C'/ [x0[O YL_-|fm{߆_`/{޿R6VPeg!]~ +x:A|Fp⅋O?KJGp_Gt.Gx.Ó"E+?>RDp89ܕCjp׺j'x5^O 5kC' Y$̼AxF#{]RpYr.|3]38,UB~C{/$uџ8~ kjV= UMjт?E9㾚իk:vbrwlZ F3@Ȝ\^>yJyO wXy/\š>z!{Pc'34rt;w,\;kȥrS {)ǤnϜ |;yOjmf.[62%=\2wiW_]Z9dҙەU;2C1>zy;`mL\jpd%%5,A}OUkὋW\Jv)H2cqBkr\!5A'g-Qi2c?e!@龙#{>MI.'q=3A38_F6lƮ Ζ!@d-\CêhX .dY !EZ7z TnPp/m 1"<0tmcލ-MQ41袘}6~~FFXDk+u/KUx;ud|GXV:H;ŧw",{#7a y̢ ƭzq #_kg,Z5EǏxk~=a>2aQ5G gn\46!Çkϲ+_/yւ9tכk G0rgM^æNm]wS#W<@$%{}P/|P@Moޚl톧X}EkApk8hEK)5g֬9to]9C O[pC7[.z#O$bh#ؿ5Q3 8-ٱ|ww%}RqG>?4'8CAjCjR{W'P;q ٧RI.Cp*΀xezi<ܫ]Ia!l[rkLl O^f.Ah!/0j{/Ly=w.rUG?ç6}gn4zڵUx%.Exelge>&C&_bxKFXVSc/%jXM8djx-_Gs[U]5[ uR]Fk,o)}P{S${lYC{MI4]#,xYץY u+nGQKvx;VMj_DTC4ۄc񊐶}+^jHMEow.\x)t=pO;a-v#}ao 5*ڒk`N_`:g>5oSUgO:c4>6 ][~Nj׾+pﻙK0.~n:5ZdOa"As@QWn2\yLΝ- X2YOO,zUH44om Î6|'}I3?zw]ƷQmjߺ5}_Gǧ=olyNkA ZvI,A54Z=p>W՚^:n3/z7ց7\>v2YP7~I?*G"$ -q5<J AAP ֺ}0{v? b2q|?ۍmp"N>@|: SsH[5`p aAڑrSpH7W7By'{\MFW^7WWO"dz=\v{ \8Ag+9%?ȰRe秞\B=zЙ}UN,g} d\ X|aQ.|84mV?7dkZ)^t9|e.>Ky(8_K:]ǀ=Ȼl'>?eU3W<1-#NsdY?5Xu ;}Ahhuu&P݃Ǥ7QSgXXŬgU؏Zks^6 aGΟ?b4})kyf<]Q;$"pV̢ ;vl]_-ۄĈݺ=zln;Cͱ/fx/ o7\=j pmֈ.^KbAjh^ =o?Ԇ[Qm\uҸv+3_5zo<8{U² 6y ?ԫ׶{Cp_,֨~/ 2,b5sE$l]3F}襪kWWV&eׅn< rxO.kZMub[%s,[6gs?\xسz̫«A/H m۽rk?cE?+, xU>섐$Kq]9uMP#'|暭8&i,= `ɢSK>8-Q[TYUn_7?r'Bf9_IWO3C)VUU \;ᅝx~U֮ݿQr}֜d xY]m$o̺4:s+m0}|뾃'dG$L߿d٩K+lO--3[YڢQ@ҵm8략Ro`D\t=0-aHN{+ nXuV/nz3,_zrkmťS >&ŐIWΝثi^@]ҏ_?*{,%W~h9ׂIIDH'HxМxwr!:yX<%(Uc&,Qt~ޝl}:4Nn늺Սֈ^}ziH'*z+AEa5C>:hh3kFUj0YVUuKĽJ2xǬ*;*H%Nsx-P+瞃ra;5C-^A9<MuL%=ZpCğPo{ ~^WrQD "dGI@՟c76y1obp>A=`m8΢x`cr%?wKټ*Gi0I Aѣ0FlKV   tR B H2Jb;++$Y$vHI_t!ddӺ3nnn[p;v.yݟp_ 7lYw}'wcQM^,?#Q'Qico16AFO}:COhc ^ژ{{XBw 봱uXu:=PO{'Kqs7P{E!3*FeȂQ.hy ʆ>x( 4`l )(|("Qxv;`O)6|T{7PMJ@}(Fh@% wD `)xNfnkG,y6KvW}+Yeʐ|f1 CP%@IaPV%d5YJMP4CisQ2ĐwѦ %;Pk*I/RK А_51 Ȅ3jW@U"e.2&f4f?ǐh훹mz5٧Pb7)=C{5& sK"-TGin`.\vw6J/p^3[}L;Z(5g 3ҒPĒm1[rME&Xqᘎ9nkFǟ PX)<3֊\6W5 Ba-A7 FA}+idx5%j"C_??Q6mo"0/,亞sfIrl@<5&W.RY=Dj-cpE|*3`i>yP5-k8m)1?T;00hw՗ϬK:px`VW61h< C 9_q'FZ$uiI;ƿ W~Fѩ6Ṣn7F.ZJC -E$y<+49W2Xym auظSA;r431״ڡ9q^hGQpDCE&FL"Sac~\e6Z`+Tiwcf6pEN ܜ ަE#Vs.s.Tmp{yT4wg[x%bՠIHStR:yѨyRSKÌ)ө^稠^y(wrDF)W6rU#q~V&& FwAc:7)B4{}ru,<x^quX</7VL\ I\*#ߡzءAwȰ樶\LKw %Z8VИ =\Er1e԰*ώH^VG[#5=Ҫ9WXhsD z1bwf122SZ,-FlZ=iT,s:I($KC#Lkq0@+pǾ|Wz#a0&tKő0p+ D(NCR$3 0z 툂tg㡈u*=4;lE4 Ts):8Kq|qƧaf8x~f=R>#*\XWesTKE ?i\ RJ,I2;jT`h叇O_)b10et._$C01-2}7x\UќR$Hj8Z)( 鹦9t*Qq 3?qY4]8UW}"EQ\Ff@UT$]c)FrR~GiDͺ~8&2ǢCEr[6H st?8k_G9$waj6T6xܥ͟sl yqvݨkk];5 尅79gէ%f9u\{Oj/z݇KS%gkZ3 $ىsl?9q}w m޺B7=zR63ahl~ OÎm4i,Mup{kR\ì Z̩ܭ;aneL)|)Y(w|s AY FS2Q1܈EM|+<]U3YL@+b(C@v ,fV EeJb ,h,T`Pi my&ͅly>xtUҡ+ 3*՜ozќ]Rh*l0RoPR9I]9'Sl,6q4|,?fb<ȍ6 JI.!. %8}*CO!qqiC䘸D ̥(JrdJZ\Tz|dр61.1&  JJ746-6dOL$9E %Plsjld|2$.-5-E`v&&%嘤ȴDeDWyQ#BȄȡLT6 'S"Cd}TRQitF%%G9H#c 8g\DIKJIk`ed\>DLKeIIv=b>5~Pl&`>226`Bn ޥ$TlcyUsgZ5 -UD:jvslVCx7T"5KM,-%IVP jS Xq(ȕfm`Q@ɎbXlɇ-,6H&f-2l@qJ8ʿd-*_j*( X eP/*ؔ\hfKn"˼íӝ~dR~O$; wA}9&f4Ѡ:JW7z%YWՀC'JWR~g$7 ~G$ߪWRW]z%m.A=$gK.)]˟I.2+eԖIZ&L-{Z&ɖI--0,#)dGwHv펔MvG鎘6 GeG}A#Ƨq~0oPx # v ggFWPbk0lR|HViVtf&jK._'ig0cpuJjȯZO r9B/3ܜ\&.QS{\%?Pr?~9Ow=ɹoSs[6=&%g7|M+?r|II_T^rOө߆Jǧ %>i#6cJ>CJ>hyH;}J#$R{ %(y7)y)Okd/%WKPg^i%kI3Ě]R͸f+ (Nɋl3[FWL}d3%(9_g74I64'd k)Y󌧴gE,\*-dA(y|"CG `bM &s|lJffQ2Ӈ =0xyH^xgD&(q0wJHDX JM%x6Y_Amn endstream endobj 19 0 obj <> endobj 20 0 obj <> endobj 21 0 obj <> stream /CIDInit /ProcSet findresource begin 12 dict begin begincmap /CIDSystemInfo <> def /CMapName /Adobe-Identity-UCS def /CMapType 2 def 1 begincodespacerange <0000> endcodespacerange 1 beginbfrange <0000> <0000> endbfrange endcmap CMapName currentdict /CMap defineresource pop end end endstream endobj 22 0 obj <> endobj 23 0 obj < >> /FontFile2 25 0 R >> endobj 24 0 obj <> stream xWN/cGTb {u[p &Ĝ<3iU[ֵ MmnK[H;}@;hcHGX;Nu&Lg\.u+]Z׻fm[Nw| A=Q[IO{^WMo{>O}K_>_񗹟o5`^; endstream endobj 25 0 obj <> stream x} |EpUW$trpC'!$$\$!\d&@pf"xDDDD@dYA"Ȳ"""E '3z~K_zUBh>"$o\A^s2[N[t2 p*ik~caC>p #>g'BfWaE4:.!Uws6[Qe-[WE(,YMQXfc]cc: bmvm~! H~@z'r H#:Q/F[I/) QJCq.A.v'b~: =K=NӍG6FJ>C`tU_ pZ ڠP8jڡ4;.+"QꆢQwD-7A}P,(ţ( DЭh0JDCmh($RP*JC(e( DP6A(Ѩ"4h&Ih2J2d@Fu9}h5']A#*^v߈jQ)@.Ep7k片@|w@+Z\kNtF/ ,`4N4Cŭq+@T# qxX1p6;QFi`4k]]Tp>@nD3p_<oQe| ?qjУ <բCt 9DRڏNXkgG"T),HuP\Z mpWdrH,[HpH] Y" Bc:O=W-{ q DR-E; }NQE2lI=Nyg|Dk e 0Sؘ?N("uB}QnTQgz6$ : A=A7w)~J(eCAE%>dL=r=\@eHpDptDpD}='%z!{ӅBf2̱Gp6G,N0p80۶  @{K4T|`>=ܾvtfϖ$d~;}^X7dnٶ[}y7#DOzھ@%1=aH*}))iG i빭xRFFRrzFҺ{׽.2❫?")Tβ;frgxwk8 8{'}llc}6Tu ZaxPN=qT$q5Dž . _ 4ǾqTC?{3{ ^))zrDFv-v9IelJgcHaǗ057;w9;#ӱsW{5cVKv̓ 0BstK?b7tȉ4] c7cCI o*<= .Oo}~8MQdgAg}/G_8zܸх-jz^ v֞yzݲNx㧔Φ?@g,.);vfw>9[}x.2?a"r>G)Ups…އKX<#t;:e:!0X^#F> Y 2CX*e=Z a8K ϐsŻ!ZLJ9A~n|u.9pRDP=g. XϑWƝa}S3qk S2sۦ$~y[/3vWՀ/W8`blF^j NK?xب>x1$tiT ]*Gn>)UV'FEvNWAbe X>J8?y)%';:ޙ7jXk7 a m|z}L{K?>~pyvgq55~B:zѻf.ZDow3F|ư9{)j(Z_pUlێE-[1c}adAwCͪ`Sc ~lwџ}/nwuY3rtо>@=l^ [GR,N:jt/-9l[o;\UvV ?0{Aݬ4zJZ"pYؼG(b[fЁ8O^؂piS&NRE qkN~vGFzGSd~dzkPҐ=ufcFØVcFt#yhu&I7qG.v ɚud+23hP:GeK܂,xnb`-Ō7a0L#j2zV5>E; {-=9 0QݤOPS #`* Ns]8'І Bk$70D\u n3Vjű&wOtTpt-5'Wk=Mv eG@m!8Ԡ?0o4kz .+7o^4li-M6m85m籈R}.O շy(qC}p6}Oxh\v=t`xuְARTlAyxG L\UܚJWn~i5?{.nO[t"rQcd'Ovi/Dh!UMR cwg1>|\y~{E8^v+ս{[=Sփ<=XԻ?]`7O-rryo9:yKOBn>m\펙; 礵Afߖ."ӳsr3D֓69ϽMJh 﫹VS.éQpxafS8ZڳϾF5,@ 8֐BNv&58_E$rz|NH ( !oӕ<^G Σ*8\"W4cyAք٬2J^|fX3s^֜#8=2-gk'Ne4kfb4ګ%|q$a,k\YaZSWv^Ӵ:)_[jg]/ԕN۩ JWRd"{'˼*r0-?Vq(4gן23 ꪮXdx~a$A 'dsꪩ;v%Lr ~:l"I 4v/;rkšHRm!>jhny~YKpgic'UMM-nKT[;H<¨X&ѬV%q[ ݽjՎ}Я6UU] q84S؂ s#5;%SWO'2~ꂕUFmODZ'O,[L/Jn;0f ѭYV'a2@.x ujm. h`Hr/M֚M6xRK//wӅ֕NUCO6K҅O9l4ƳN[kcx['k㶝 m^ iBgt.4j|Qiq8gП3Papf{.&]g*xx@kGN4cڐIϑ ]ˆNfL[aiqKL)m4[AؿӋ6||Z]6^up4mTu*p7),1܃z^b'Fzw8[miXyF71%͊Ӧ2Pj6+A, P5oCR 0B-NM"˪?_Vm {Ͼ=;w#}^y @^[[ضu [ML:+/]8o[9$tG/zz+/;֯UԪ-*  8_._غ m|gJ+y>0tlmPZzUVI+FjD|cpf5g=qXz GuД?ӄ֡Im,6/ݴo6&ob1BV3,ˊONVN8j=NNR,i'. b஭mp x0L{i=]@9΃0^m:Ḇ>Ǽ\KP!nٮ}!.<` jáZn;.iûZ%._Ձ:q sDY:Dlo Uӈr*&B5 ݇b& ^Pwfbon4h~ۛo3̐3|j˾˪O:ڷG>HXXqvu_}O kw3m5bqጨssF sf<ѵ+g>2}9OV/ۻo K[ Rֿ89O`2Upvu)}scKR_3^dAN𘜧H:BtCs Q**PԆjZgDe)ۧǠ4cZk3|s߸5 5ϳӝ}.՝n={ZKٚ6@x]+W˦2܍M%^;* oN$O'*[1ѕ~Yzoobq@+g>m?G:JNæ|e}xϕNs Uh~7z^YHzg DaLFp.%Q7x_E Vx<[@< b8gY#pڵgSS}8 >hf4AGůS:&th2;KC2|v{į>ߡ"% l ݊ ,g; Lr<@#0ڒjl/T>r/^R18rj_AukQuv؏cw.?e'bԝ,`p>& k"B;0@0s YKɝ/SLũ\U)F)-m>tiɺ*}պmt|w]K|7VmZejCO@lk-9_~;__Lx,`o{\ 8{_EѝJl/ڗ}uÚ|)1 ?jmB[MP@k~^kK_XkP;EHkdhL&j who>!$Y[@B&hIk6km hm'ھ(~(kDG*h ~`:6 "+ȎLU"'R`%Qz=<V)@((`Q f! B+Umr>%m2m253 ";yl+ x"wjhƼs8ˬ<775U\=|T4ۛݓ?~-|&b3^(n6d6ԙ9͓ڛzTNN ^6: 3*$7Id2{YQl^U)s{noers)kxtl.7Y^w#raK4Ke#[#v ܳm1}Rkn?oM-h`60h4*H^wƣ{ҍĝZ>%ZҪ9oXuhI6w$ʡk#cq b|ȼJnʪdTZ8IS#P:rɃ"4.  M1ph xiUĵ(i1܎L4>QšT4+KK&ʅ\l8..M2wuN&6p8Ǵq^VIbvcqJ\#-JmCnKЅtjQ1˚Zũ^M22ˎO%s5i,#jd3s5)┋ZX*ۺ)F2xhi0Og^g#7*.7LqXؤ B ^5wüV9Φ|=ըwk+5 grX5p^uYw ۽:Vkyw>]ݴz >Wk@GSUbu2ztwbmc|i型<ԺRϫFт6o-]tPŹZF)|:޻MArk+?n?Hnq?H䟵Լ/ɳy;-}%}%+y+yvWͰ}%þ⾒G?g_I~$_﹯䉷J7}oJmwIFwZsvhW.}jewkv?W~ϛ,{zEerg(Q!]o0iZ,oM:C4ڍ@®1 ;@c c*zLf;` 3 J0-SYlpe;g$WId/@fP̤zZVm6Zz'TF0J9ًsb7VCu1@0Six 3UU'3LJk14B]U%v<'F12wGeFծ8`6אfZSSVU ͨǺn3Cy|81tz|*p6&Pb019\F.E&'X`ˬbxNqTꫪR5`DLN®vcb+Ι6cŪL5kτhS9  @7XWu.3BTalT p㸖C)0}U1n><؀=KL2nd%e S$;/(|>(|d^4}At'A[o`_o7 ξ|j-7 0M35A3Vie}ۚ8$#EG`v wCEr8&Xﻢ]p vBukӞ_k[~ 0kbmCx Ɓho͟X}/E"~h<7˨;7IznGW6BX)9\pރ%5!j@ROOW2+zr(E.Q%) @7eJ|9Y:Wp,%_֓/x8CPrQr)9Igħi;r|U鸁|r,Z&>'}*}N> > %uA䃣~ 9G 'GhDJ%ڐ{ɻwI;;Iw&wmJ27 ޤd'%(zrGDgwiO],@jwjɮҮd?y FJWېQR-y=N6d6Փd#6!/Q;YO:J^d-%/d %ϯdu Y$>z!gl=Y ¯Ddӻ<]3IzzyzXhT3$)y )J%`.I B'Kk(nK(Y zXN "FG(YD_(y(yhr%RrOYMJ'd29̦dV=̤d J%ΎRu=qv$zbCf1ROLd*%&J*8RAIy1dHA&$TIL%a~)RI"ɔLd"> /Mask [0 0 ] /Length 34339>> stream xRְC @=EƲta﩯8r֮ɶа555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555Ž—CN5=]]]ݼ-=w~A'Ү \j` !@}5ݶl_Yv@;׼pkk!4L,o`k2ЀMA@ 6mkMX24Na`k:ЈMA@+ 6kX"^hM5;^hyM:53^hMZ5Ɯ+^hyMz5#^h&`M@6Z4o5XФ9M56lr F4j`k:z U\k͚#^h&`@æ6Z6m5X'д)MJ5Mlr J4n`kZz u\k͛"^h`kfz `\Ukk0.^X1&`: 6kVbh5X=ÂM5lr .^X|5z `E&"55\ˠV%lr .^Xx5z `e&b5\ˡV'lr .^Xz5$z `j&556ER_50z `&5*\֪;\Z]&5: 6Hq5Hz `Meklr .^X`kp}Fkklr .^X`kp\.׫@PHo 6Hz `sM%k+wk .^X\lpyFEkkgÿylpl\"^?k .^X\5H^` Vj?zMktk&5U:̵^lpia 60z `s\>'vk .^X\;5DMG` V+:zMkҙk]&b5Uε^lp)r\"\+`ˠ֣k^lpjsk .^X\+` V/zzM5u͵^lzz `s^XJ`k+P˵J 6X7оjzM5sk L.k^lbz q\ `km Z^hZ,B&`@˂5+͵` 6X'ЮpE{M*5fs-k H*k^lBz Q\K`kmJZ^hR.R&`m@5+̵ק=L5rC(^hN&^nl" &`E@kv\k>ȵ\6a VC%kB]]]G&^hJ&׊*`@K27CrC% C4$AfWO*5vdVrj8`5kS5׮^lz ] J+y컋HA@#RnhjMA@r[ן^yMA@rʵw 6h^hA.ׂC7DN4 k_<`5es-Zwmkt{>s=kW z 3 gϵz`{d&5௺j$R˵75Ձfzm`5?W=_5loz6r?t`5C^5 9=Chrm`ε5j Qk`=M)aϫwv^{]ץ_:kAWi`{ dЅkEڢvh`ۄr6vF[4tk߶`Z.Cۿ 6-l'} H]rg\u [GnSꨳMA^E2V-?@g-lr V(L=^UIJ6ez VLFΦeg6=ك2v%HTٙMA~`mD\;s5>1*E6-ч+Ev`kOs`X&Z\ LLvM"3\,jNwslkc;K5kl%t>r'=\bg6uz \WكMA^5s%*l@%$*l`klCs%R 6k5kf dl15[ tlr m@}lk`klk`^\0pl`X^!5:w& A8FT״6&6z ä6 Q5i5Hk]& 5], MA^4YmtoMlr @mښ&&MA^($&i)2IkMriz d`^L456a56ٻc4٣g$`P62&\cܡ&|s z I׺sINu05>#m⽤n FN0z `||k0^70&ϵ<RPz bP͐k:C <\@̀`%׆v\tX5t͔kϔk,`P r-{r-}hc5T͘kϘkɃ5ED$m\~\K^8z $l\{y~] 95I-k/w_%Xž"k/{#y}(r kA`92ȗrc$wυDhz *l\{;ip'տ&ko]<5j%r>]Gj_ɵMa$HվH@\%X>Y42XH(+_%` z 72Vrl\ 2k=ڛk_ɵ\%*`z lW 7C2楃LF r &r Yȣ}tej!u<G)|\5`KV밥r1σr &:-A}R+vksʭk0vl\L'N8kD&NX@QxXs:Mh$}NZ˵P$]m#dFr5^b/ؒVYG's!8 у`k0-0O%s}B|9keE>=lr 9|X?kC?`p_KLE l\ ZlE-k2xlr & Dv H~-k^K^5^;2H-ksr &:G֚33*G^jﱱD]Lk{ 6^xMkO'-$} 6^h[p+i*ӯ,ېd?RSk &Uj]7z3l00DǦ`{ VRuNrm򝱢;v`i5zw1-v2Hw}>[?D$@Ϟk{@hX?[v~Ε=63=Jx>f5*\]_V_篴Jk$b#ɵLHd5W-2:^}Z.:;z7׾{M@~}Z.N_8Tڧ3\5#5RtZ:2V*J[ k kul%z=[Jk FkUd{\=J[׊V5c5)Z.½<[^V5#5)Z*آWߑBlw}٫}RV?`q\{ I~]V*|ZnlMc5om^zuϵJǂ=2mXr=r*{YTb١\M9lP׀,k6 N&u[SbC7D-kH'&ؠ^d .8•rI]͵lAW6•~lFVR-k(^t+*>`KJb+zl\{$C 68׀f"赽`It ^ D1` .^,P\ho3To4` ^I\~v|L|jJK(sGI}.^Us6GmBp{.DԤ}.^ׇ6{bdϵLE1ko&-8vdz l׾supE1\I߹5xE1s8žmwcwUNk<@ܴ/4 `%%XA#lODw25m:&7fs-lb7DcC[lܱ*lu;k 7.-2;εdnZJ Fk ;]dmI@ s@@^ȸIhR{OT՟` MjuZ.^S}rcz ~28ݹ @6gs-lgbw"RˤHjr-lLL #5L[Qε\gR-r傭ެ `,lcsm`Зk`{ 653ln~踛&%k0^H{~Kf̫R/\I-ג/tGlh$@^t:\ˮvI \K.1 Py>cZvVψZv͐Uz `v_l0ZzׇCdѵh7~6mt$@^8h--k`%ks[<@I& L 6h^8\l\l<p\/ز&`qz 6WsM ɵymH 6X^߰\#؆`e5 ͵mh 6X^\:؆`%5ɵimL 6X^׸\2`5Y͵ml 6X^\*`5Mk&`!z `>6M 6X^T6>ئ5ks.t&` z `&Sڸ`2,@c\l`k:׆Թ&ϵ6} 68709rmX͑k LLo\l`k+6W 68+0r-l`sk3r6g 68#0ys-l`k;̵98g4E-kOW{6wdlpz `BȵXr6Tl BL< LnOjm$^̹rl\{tu$^rl\{<δ_Ȣ! &9_D3O4Λk}6]]]% -k8w-k/g׾mt kS8-Gn#l0/0%r;rUs:l<02l] N= IhKir-2`l0'0rvl-oB<`5̵`Kk(׮66^g\doFo 6^e\ۛUKw_Ul050v7׺aMsKtf(4By,h!Z3ziZ&ze>n^ک\;\H=>?x\k vuN-k%%ډ\;dJ=α6k0/f~=ӒV^X*ڱ\;lL>6)8,L3'?zľ^;ҝkϩ/.\.>'*ATU~0vk]\58{z&΂kzTn<.keځRuZ6R&|uMU^X_Zkkɨ\3k/5vnw;=z\+Z.&쫥C_v=E_/^>赵ɵR*kr J_8&{_'^[\+Z&½&U2flk֛k^KU^JFt> s7jk \skPTɈB{/^[JZ8b&U2".uk+V˵^&V^JF]6^\`dEzMU2Z`mjsk \%5(dD"Oe<뵷qor<<|ucrkЪ\E5(dD"ƇW`{}vVv.yzfn7 ^{{m7Gzv 巻F7zp葧ɵjERkr נm6)w{w@^{ o@v@HnF8\Z j&`!z *bv9o!P*#@מ#=Tg.UUPN,k^V,EAQ]l]_W {5knBkHۮ:(wFjp\5(\TQe!b6Y=2:NbA=<~XS=g-hz\&`9z *Wb㪿ϿL)MkZp^BG|,qz(kO#k^DW_5X^5|O~/Ql&pﶘ8^{KM-ezcd\ Zv\%5(\Zi E4h?7>½ܱ:gDE{7ʽ&`Qz *zmڧMmɳ zmĬTix^Kކ +Pcer-k}U5kPT^Okd8Q S`Z::>l\ZO|zMU.^ DMdž=T``^{3xLe`ZU5KkPTZOk?{mk336^Czՠ~$s-k]ᯁkPTXOkLϰQ7C?uD׆,;`.sds-k`쵻HAQZ]Q'fvCUu\M1+uqX \vϐu:IZ kr נr}rogTM3+^ lѩ#2^*xi$s1;Ygu\5(\mE鵷qk|X,kC'Oo D.׎vAm?^kEKL9sU~-rTvP y<Rֱ &&DG\65(\2hWi:N #u Lvwwlǽ&נz *W{?;#zmN` /<׷2+\{,l$NBAQB]OqMD ﵷ)6v|wx{}DS3翃4CAQB]tgZym_;{m"ڈ)uIq0U ^kE uioݗ6]S? o,k^nSzP7]iMmwO{֛B ݬ^kEkaoR/;Z+{-vi ]/k,so}_}uP e[w6dOkr ڢנhإ0&%>cyw{UB;*W:{R/ϻGunv{IڻQvNmJ;oV[v5~y}kr נr),ZdIsÉOu-:z?v}(nzx:-|;-ǞkJ\J?o}\5(\ {-Po~E> ,^닡Mi^꿓{8IAfmNn]#<7ږȍo7f/|o&נz *W^ UR隿yga_+/w|=CֱRϹ `j[m^KZtr#]5h^ʅB/RUK}]MJ;khTeqooo{E;'W֕=iPVu J*dM2ע>ov\5(\z-0uZvhڇ'Z3y뎻2ocv*Jw0kzN2u`kE aeYjtm+V8Z׾B{fX^@~ç츭کu^KZxÇr#?\5(\O.ӯKkO@ukѧv=jk&|=.&נ-z *ShM٣rOnծا5Czd_=5~G zq"赽`kE}y:Ex݆Ok6A.[}%Y zmO9Gt?*0-E btOɫ'Zsb' eڿ[s4Gנ1z Ĥ{v>y`^m0g/ >ϯ]ڦ~o+ؠ-z Ĥ9ھRWt8 V[뫼f^ϩUF8zIJMkP &%2ZLͱcp%kVyosZ}皽CEz Ĝ^B65R{C{-ÐyV{b[@CͮL{L~8E bŽV,{r'phվh}vm\6lU{-o؟UlEaϜ'kJs9:ު# g}z7}&`5( ]vŭFkч\Wsˈ^{N2Ebyxc=GPnƒ5kP.ݚ;Q˨,K$݆Vki ">v4zD&=c/Ǟb ؠ1z äoo~+kǥ321^#7&vY"lz#TA[{N}A}ZxsS7K^{ ?VIx!KZ` k x6h^)Wyl ﵁7D?]_r9iZ[zwMlQZoMAKMs5u_wz-葛ɳxvMko JF(/+ؠ!z 9ɵڜUS]gwYT^8Лk/M]-k"շ`v5(Z4k#')vOzsTqƂ3664DAф·jRJF=asH, }o\[q7C? 6h^c9?o Y3PYe{wIsm^{~uw;U_ נh+z\z\\]e,rxS~Ҳwz[k Zנh zacm::sEfm;V_#i^/@"&ؠz &a|=$0&1X;_=ǝÉ{퇻],֢&ؠ z $k`2;f6ڃ[cW&9DEsMAMq-؆=OJVa&`Yz *12}]XɳbMQb2{}(HK굡&`Qz *12}[+ 5Ne^{H,ϖXh^k נ/ӵn+W'2u.$ۨ^M)V@^k נ/ӵ+QO3?ϻqVvG'F^k נ/ӵPmWv'qVd^k נ\+еʯ>A8T&U{m| 6X^JFLpMH~E鷎{sڇI]ޗ4tMk נ\+SݫM4u-2Crq^&,CAQ%#&Lx|mL~|>$pu{^*,BAш.>)R-r:wVk/y]5watU"|U׾^.,AAQ% LW$祾~F {"7E{f|h壥YMk נS\75 Z_:Z~Wnsly3j?iT{m\lp~z WA\mEsk]CϱnB0AU>ٽ!k Թ&U\=V]CWR 쵎n%J;һ=9y>^s\7Ds>SL^{|zq1k TrjsuϻZ|Y+5gנ_nZ^+>,w}xt EGG{;syrMy5(:e:f^V6p2WV`+n5gנ,꒹t_CZ}{zW_M|&2]]mR6_{Nk]kݸ6'~m\lpFz *.ͳL <<)GkA=dkg2o 68E+TS)3LDVXSZ+z-5rU%w̵ׇBlp&z *Wzm Mb:k9`;Pr]ڢ_^ʅyGRѵA~f0Duװ^KKLwٽRֱj&_`kPT0Ok5Ղ۶𻓦{{d{-^^RF I]&^9.nG95(\{{6X^>Q5gsLYhG1L7FN.^uy¥&} \<5ݻ~V%=2ַ}`5(:ume.^{w=O(M a &z-k6h^3^_&{wT^Yi6iyb'0hmclצ?`5(:uy` Uwdp0`}['x* RT4@AQ26<4VlO}q7D%9עSeGG}~G^ZȣcV(l0/E2ko!goxE'؎*S?&&"{+kUQ* 6^Ul^Ǿt޸J=jI_諘,YOVS;Y-c#O6< IUf&mܛR(v _'*dV_k럃itBmۣoJO|Egg5L(#KST>tf78QO>wԃjs@zy7cȝsuwggy[Ϥ` 5ػBvOH<9}o#~vOM_ӄ I&;#-`:z "|A78xCdev`5 膲wk_l0p) \Ԃ .F2آ޶K$H[hYб޾VT|.~l6^ `"[vO|¹0%pIrv}Zg'#͵LI\TE&"k{k .K*OE_ϵ^l0pa2Vۓjx9 zMTK~ 6^8`{+ؠBU'vk\{.ؠ^^%r-A~)p[&ރvu8WvE?A;n3׾m>\0߃05 7zs\ |k>t킽sp{5sz }`{ ڼ 8 P5-vCy1eku ׼ 5-2fz FkH[ 6O8z S`{N0^C&؞+2h5d7g+\:@m#`4@Lav3k^:~KΫ0@IjYImkv:xۿ+s+&(Knpp `:z `f#`yz ^ '`iz  k6X^Ju l @`5B,F#`)z  kD 6X^ L"q Hl@`k68;@`sk$ 683@`k 68+@`sk C68 F0`sk $LC 68` B0`sk c6^`k#`nz L0`y5Fl0+x `5 `>z I6^` `5"`z |ˢw-=,z }Àˢҿ`LJ0mAekmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkmkm[_`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ Xc-3I^Z:gV7`t$nz kIZ݀095`s&iukXKLΙ XgM`uoBA[ k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;zzgBZL]_Z k@k3w~ hw&.د΄5ޙл`;v X]_C ל:gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs&tn^Z :gB5Ιйz hs& k endstream endobj 27 0 obj <> stream x__?cC ^:?7p}`D@$ endstream endobj 28 0 obj <> /Mask [0 0 ] /Length 70278>> stream xFwG&R:;}1Uۀ([3q;6,. | @55t_ | @75t_ | @75׀^/.C _joߜW2{TR׀VNor16]_:y',}5@Ik@%7kW4tP}_ yP]{,5ǁ{ _x2]Cm:/8&yB!5LOXc89ў t 5䰵fJZ@𵖸.Oe ƺPAok46_k^d}*z-}@VеibNkkoo[+]dv=8_okozq2ㄮ5Ցך`3Հ!'tvæ.aR1$ ](l#tnvx/d`^E[]6Cc#x^@<; F׎tr< V?L9:K_4aRt \ RUa㳽*^;l@^{{;8l >>;||z"^I9`׏>]Υ/V;8]{;_k!>"RMtD1]Wl2>w`ksܞ!K_ k: q } *koo78(_|rC5Lѭ ^z@8ʉ*KATאZ).*g}tZ _%@&X$tZ" PM(t b ]6kuXԢ\V-kzZk@=fO۩u?H#dKpH`ku׊.AX?-Ztc]0/OJEA!8e@}hzb8Od$5Bls $@(Z|m}wB#tKK\3յ7ZĞ.~6hﺋ;еֈ}p/:BA_Y\u@T.Q8 +6Pמ{<NDUC*ٱ-o59θz~(k8ǡ%^)Vvr[ۨ,fJ(kce+Gz|W+u]kZ2f !ޑtTE1_of3*/C<8kGY#ekOgc3?OϴtM( @󵨱B? {RDeZuD^~C͡-D)_Gq3Z8ؔ[Z춛mHU,9OZ)k;y$-Ȼ)Int)7Z>]#]Dk(B:k+P4v̝qd[o|RJk[CBhAEk%Bt5B.rM<3W4Qu)7(خwLY~Ql78a'-~ZJb5B2?ھy $p8&0Zk%;lXdyP6Xo@ &G;cD0GUt +(kC_q-Zz}zqw _< ?{fÆ,SشsD_KS,Wh_hĮ.͟]+/@;WrtF_ SU \/3]{m Iv-5| }zG Q=7E!Rc㗑_:Ɏ[OCk0^H6 k l|(Y=MSVf=~ci4lO lgV &E{aAe /l76I)k CKkfJU=8@׊".l!l2v-Ưq7KhiL:INU,kKwE/Tr/+˵蒌{ V-TeQ^( f^vMj"=_,]Z[Y1t$Ej5!47Zֵ(GD9xzݱ_LΙ? ,P@>selPaY"$WS;zr_+0X=\\>5f!߃q^N/ƏtѲEG k4@;%|m#?9G9*-!v%= tM SGc9s]k򃌥kK[X(w 6@׊B5W2t[ݙXtڨKqۺ(ځ}f&\}rl>mi9G rh_zn{jMx(8^zuMɡTǼ2&_{Cv~Q5P<D{!<ں>) ]ӆx+_&_ ޴rm\$PE|m.ٰ0]KX+}:N&0h0(n[@D=dCCudO;)ck|23uXF؄}?P3"lG2P%4Y5l"8Ȗ'B42]<= "f婆UR[]!h-=G]I|5TPyp=GO׬ͳdrߌ't J)k 1aHFEū_YD!XaA_C U P"(kƂZQa30yؑtM仑:)*rmap(t z)k)Dҵv7$_xt5fM׬7SYJKkK!_{ۍkA\tqa; = VƳ"KnE!_{E.m6y`5H I:t^_xSB?@,PO׸{A3ygM泘TB%Mp0*]nJ 6Z֑K̬@Mr>4k^ tp.p]SIc-U4ǠM:J6LVL&ʹ]#[xH`b[~% 7qWA*-]-#lYzеZ rzlfI}DkZ@<(&4>[#E@dnrT?U,%n5jצێdVF̊>'i;%>'JJM:Af{-Y&hZ]Y3>o#*!4y(OR36Mf{-f<t6h#˜vZ oQ^@]R|J_iG\_b]+ lqYLkAk\ת&He(0^-ũ]Gą-pN|{"ئk~uVki!' bם5e5^H*wa-]K#<6mDPR ͲOHk\?*I507__Bz|*T/CD% I [Ƃеziy5I$JXM ** XYځaCXg*a.Y–`L)KfXmTT> Ϭ@?wʓ z}N4Q7'Zv3`D*4ʮ._㣣\ɞ- y)-Bڀ&~> :Q"倏cY!V\`3$h]ߌc&t!tHdj_[/5&7(@,Px/H7a.gXLdYе Aa)_ľf-Nu'`/ϷxT X{oFw Wr9R1ଫw#p@vn$5X.kɢw1d+kV}S`3[5pk/b-ck @+,g*mGϐ5k\<x%9xaWy [ljiVVЖʮ*+ĬNuSi]zIݠF ~ 46=Ѫ,Y/׮.I9H|rp*kkf`fZͼDqVf|*R1svAE5egh1_+kAJ//Rl$5GSU)H'Ah _ͩ7ץ|!HB)gcе&tܷ>=t"ba,Sd[Ur% VD5ލNvƴ4KP'uJK\=IG*d;ܵ6Z**L5 Rn41ZukӮtuڳxЁʉޟiī-E|I5f` 5~P9*xzڧkA1v-P_/1'AE2Έ-u"\BY$vi2 ٣ohXߠӏuFND^@gZY|MY3;-ckv<;߶ģêD{; >Qf)Oq_ u+3WTf'w7񼓇izEpH_׬Nk \aV﾿+,Z5z x}BBz_faJon=Y m}`kVAڬ KuNYu=2 }]vD?![`}}@/&'5Ukָ#-&B׀ Vbe6t7~$im F[jUk:/KľV}ZAl4+=2 9[M;5֢TfFo]DkiӐ䨤6]b7t ,B^ͰyN:,19٫uwnkD'_pG}WӇ3|W Wfe4xeCư @I0I;N/Os 6C3b[ER̼&"ō9NG7.1d'E(GJ_SBv #ֱk51ҙ6kU7x vA75x$n2'GGc8}3}# `vF1?vO0TPTz3ךյO|i3 @@܂cf4ftUȮkv x_kY׬CgM]D .~yZ#1wnp<|7>kw>4kV3Q33sd@Utk|v&Jn˩UaS sM}9@_e'O.|5WŧggBHArEs7ۂO.=Yiq}( BcE6,|,AsT]KVNH,I#aHo'zanVDY/_k 9 (VzooF2,'D؁gax=ҳe=.jv-~8vECCctNDwTͰXD׬Lk#stZ%voa1Kl mm욅3Q*-H"kVڊ׬kRA㬱2! ;q#t_S젿Fz$ zH})5 \iV3m^K8+5 Xp}%(ķ)~2VpDD)k决bZ25Oxȃ!d(,k0+uϖe^@ }*\!{4yQF<$*Jr'G'PAL&>O~FD. Ҕ5~x'_[衪yI/}X9@:FJ>.d<(B1&}H آykK|_IZK "P8HuFrp +'Y?uN0e#<ek<0{s_1 BMC#޳lmXm)H o@Ϟ*y2JUI,[b%ټ U5+/rX-)ےxKwVqkoO|zjK~.cC@X=v!.H^G+f6#w~}14P|:/8?|{ܱ;v%p{:}s'NS*վ{)TY%3cvUf5u^᳆\ryLrh%>׳OR}.78†@4B*FKdCtR;75x^{pz񋑛@,ʔE7WZv/M %Z>㬰Gk%yty@hyAGɮ* Jߢjߟ@/d4 6U>O;oipkPkF(?Q[T zt5 : MW8޹;;mX)j2m~3at}f,{= b8o1CGG5_cE"AJ ;rJ+?*KfnBhfCRk!Otm F|0Ǫ`գhO#w:t׸?>kר=5MG};qCrWGKN64?\,gQk]4WbG9%^l-)kV?EǙ7;]jނp:ꫥ[)]!lYrh5Z̢\m:52(jhZ cؘnN.S;Ƌ@{_meֵ95bIkRPhPBQkO.>ųM6pk,~WM ƺ/VTרmc@(5>}b%^ &at/}m3 CƎ`V`*S(;~]19(\NX"cp\}ni@غ Sn`WYQk#K3*uM,G]gY8t1Tnux5:>m@*[keңRh|GbV'_IdMxSV«4Qv3LB"k,X>Ia)ji(_cї!t=~XԉR_)k|ٻfe?!uZ-+f56*Z[';{Z|CLQ1M,/}mqabz5U4kuojLp-h5UrmTTMi_c!)VТhD a>}vV]cRP3}U/9| V9o틘XBń.]A(@Ŕ50~Yql6~_c`N}ۿY!e*pTLQ_cքv /y|~sn4D'f&|,_>'EQꥤޤ>;t-=G [-T ~IޙOeA}|Z ړUHo1>5[F;|eYZu#X]P+|-歹 [Q&azaM zU-`seHĖ@ (|]d9=Rܕo~@H\ް&v{0JZŬڮ]|p;7߁.tE*ETz @,<8loɊγ}7'Ql>2B^k'*/]3;uRrU`Tו/9} ¦24O&Хڞ粩J(f'TI_ZW*lL?(K@&ȑ1QDꦈ1]˚`ȵ,+E̼$sZ3ZK0];uՐsGsP_hg%|mdw۫V4ffbfg dt) b*MӘh@5SJPüuK{} ¦ )AḽZ3D5\ N6cv_I#MF5[浓a6&iJ?m2Ҵ4&= [1m('TY9W"Ghh_E(-@>412 ds=).mF("keRY\DIs#kHsZ% ޷$rDY_+Uш82DԽ:|7Y.-8JUyxS5'Tq] q`Bf97֔d2Ê7#1'5.$}}rR+y`|-z6vT=75XNh5`Fa `A_+k@'TZs6Q_>5(rW6Js4x|\Nh59_V =e-S+N9_s<75Xf,1y,| I<%t5KJ6mO2:=L,AS%^sjzɷFQ5fϲuu5VCi`?/:XZI\ߴ<[̉(zPBB4 =JL:SEEg=!YCL W2#Ad3( kJtͺE'vlwlȤ LjT[pCJ&Z.ND_Fc:#ݑ5ɂmC~O^t}[HND _F e)8 %wuT }ޕ:+H%Ef[QCt%lai$y<' 6Yʶz=.A[/>}0lg]{{cȝh"k-*wkuMA]Q@׊xƦCӵ>c[е% ЈY@7}\׬c̕<~1!>s>Jh\4/QK[Y%r >"f5@\֗?d8l5X·Z -Ƕ9c[Y:njеg4ܕ<~1k3h} yQ(}1krv:4yZG9[>?YARBu X6UD&`tZh;sP 5^R@Gq:8O[–EvO)p(~3ecORLMJb__eK5v濑L2<[CWV݂74:@g1} j:_lZպ&2jKV|b=-iQ T]& 1iG0˩` $uN#Q` ]3HfB>_x8-b OSC HCJ_^>|*_p&Y.ak3:FD`jւ} H]:bbf Ɠbg."l|M_놈Paf+|ާZ@'|ZxAQ}v*NV蛌56^%wsߨD:Ll9b!hdV2%>-<8Eo׬|BXd/!u+]FR$'WPJ*_kG>q>Y!CW%fw¡h4_J߈dJ {mhSh  [@-|)]z$ b+֏Ic3g~є3CZ4ZaFRPK_kL׬4:AcDM'Ew{H [|B=/OgUUYg`$flx:ks5[4s{lOQ)_ijnn/ e4YRZfX6-?xѪ/196 6+YCRO ȶMdG H@/ |I]TМ:tyH:'aSf kUr{rlv ?=Z2Z=#7G&DFױD\rWۓq \ׂi"w|(O,y.|ڟ Hn_{@][a|ML a-١Zp[h.*xo4^_k{R,c!N}YU)#f> d–TbP0`hwjvZfF(җ(iM88G[;zR~Eo46sdH[q k @[u>:Ak jlY3ʬ1H'so4F/neh6|79z|]D m\W+kn-d]+fĔ &nY%wy乪l)o-5+/1Bg}pMCf̂rgMNGY30Q[<KAK8ԳOc :˥Bt0\99}ЀyZ$v$TȒYCwTu@e=:7EQ'ѵOeD@+y;/.@y6/G~TIQfI?+ha"u%H1a>=ߖd;hC@DZWf1{t 6Ũ=_OL8l{ztP QC_դ-:Er2Sz\1--Z؀ǦhAC%t *~uZɯрޜu|0GW9}y0-/PvsຖxOM e7*=4uJ;X,RJ B5wSzoYJ媡Ҩ<d5qa#gkT!xqwv@M3#VZKjd _{|e|&"-L_BHlf Aiř ?@ts#V*aj'0Jp/7`.uOܒuM\r~ '7)YNA~auI*.e$_ Ä-ӋjY$@u-xD_6d ]2|]otsBXkE b*_ۖ}qF 6(RfT&;L=xjaܵYhe6(h`K|/Xӂ=D={F k6ipb725k֙ol= M.'~ V/Sq+oZ"6l125 ;bSٚ\_z=Z8^цL,s=8o ۴JZF&?]DEsI;`6M,ѯ9clqkߟ*ke}>%en9W]W~u3k;mʜO^d<oV[u [ʿw1V5><"|ƶ9buo*@_ۼof|&{t%ZH [~F<} cPӑ~&p}>~ VVaCiF !R3FI: /nw~ VI2_Jt8F&D$Y5ގﻅtɘ4 Q6y_]5!a%b5#R"1(xm]#>OuP% j7yͲ 5açli^>Mkox7Tv("j&~ua 秔5ez'l@_G5'UWu5&z5ǃ|9hL)kրg<)%[~Xob^ȼzCZP8c)g uMB#5Zax[nDrM}5&8G}@@bPI)kL2 隦CP| cJ-0ܮQ 5Pȕt`bL Vgב!$,Yw%7 _@p=?^E]}a"Ռbo_-q>ir-5-~ Hq]+XޟK**k|orc`ò]9kl}7ckĺ㻒my5]eS(y eaTf+OV–!t X5֠ D4Uؕ‰eE .]+lӭb$(xz|-4oп66ȿ.AJɑn YMHP^']IY5~WF7NeOEtz9/%,qZ<2WnȲTT4˾2#U)Ef/IR/Nzl5B*Qrt/Z2UڱK&_Hw @,ړiGHl@=!~λǮ\[^!LVrߨfL=;%l}Mvkك=zr.S0 QR~z<:7vI[_d|뚪"&lhi<>c^,Y1|Lޏ{p.6Za ř^ j]%lSBЫ/9_c{*O*b=[_e)giwl !lo55R=,ԑ(_Ӷܧg@غª@k\ۮ[ɆotNJX Ce(zZoGRLp>iD -"ܵZaqǽף"pZJc&E sca"e{X-s &҇3M?.5kľce*VP[Wur( ]Փ^ئO5ggv5\Bdws UgD +h$ڑ{$Z.Kp@K}5X/1yS AƄM] H-.TGU."Zئ5tsa|: aTcܘ̍X @1 %+5+dwtk7M6ךյxa3w| 0]˜]}nWcАB ZgO@_*"ډ6?_{:v0T>{ m_i5rZ?ZP -ӦTtg\}-E{t ;J4Th}ռc4k45×x]^ɗ_v&LFtL7  5c?ݐ'}VXzm_B Z< V7Z52'zo6֌|3vpa54O#]kz<W!o}Z*nmt'?=|F8;Nz~˷lG>ӯ!\>u8BlOcޟ¶~6 M:01̺x!k?9 >?5iHH1:h<5ó+#] 6s7iwi>e|KҮSQq–-ֶ)]kV3}U3}f=0y9⨣+;G[ƕEdtm[(6_;}H:U_;8芤 G$m(׹EZQ>Vp?q+}ZR=&^|cڿiˑObqu0\'"3 L7]\ _cq8¶k] ?^)Wp=u4k |r'8Ea6_?[}6*p_} t҆u)X_ez\ӵfz8dreyx’Mm{յ_|k.6t g} fGБhA]4%;~O};cmX7 kZȯ>-+=|>x]kאÖ{Fyg|? migu.cNYF׆ Yǚa=5K<hM}N>oٔBZ׺f m+=o'kl>]bZ+,aS:xx$Zf݊q(2O땘Һw_3?asE{8*Xk^_MaqרY=wx\,/q]X8L>[otw4(#$^kp7.D4GVulZO*Dߎ ?r_`G*cݎ<7388t[Y` 5uY%#~F|-Aʬ4aaKXV,hbLaנk0Z8!xr擰|\/ ;K[*`52 IxkEg}Ѯ/\krԆ~5?X5/LoL隣g2I{Ǐ Z_B7GA 4clI֢!/aO˱=t@&3t:^nU]['$ MLPGZ_׷<ݐZ5-0i{Vv\tjF25Jii@ ӵ&5@ODs%׵ʚC8wG`Q0 t}b/"9Yo- iCH 9е>aF.ibh"|>j/ ~Ӯrsi.fdT͌g_'kCNDP`'T(5P&캬bi]ג4|337vb=LŊ,5.l?6`eJN3-?W$,HsV o,`'"y]#s@ɹyBa%Nr 6c\kq'?}9^)g`.* c޽0Ϟ̳y]#ojix@¯7е_$lf呙KM=45tӞ'أcd.d:g:Aa!޸ a?[57R5,E޾P0$iXi.kXvX]9? ,%۶8ӵV_ 31 2fg+tm vgض6޾"Io`>vck,dĜ.tm>ϑ [k zo5>1`z-;c75wG>tZu0a5%lIm݊a2|dCr _~ L N8|lAŭӉ}G'{ +Cl݊34kg0ܮ?\vs앛[_&|KCl/F7A2h]L5-qKnD/ULOOpo2qޞ ^v-GFPN_S$~t fEA2 {o{0ﲞxh{I$_-꫘/ZK09Xk,ڵpt{%/gݻl&Њ]y},O +IySY,膮 _,^ ɕFNظ+Fv:!eݺqgrm1`n~󟋝.Ta^3}:Vsx]/}7j2]ȧ\Ӗ[ZW9K{78?e/{aMwlGԠZe_cۛ*Y ;{6vJq?36= tjd}:h"d G>у X56gi`Ttm  Nu=I: 6уfǟ}8u OUْ<2X5Kѡ,tk2M>1]gW)U0_:~ކa#%2#5i`U_cքG]#pq5lԊ-lJ t͏Q*hH\eṆ}2l]ZlihZfNI9])גԍT9QvG{1H[ Ϝޞe+HTo]#g|-ECpCXյõr\)M6ÆT`?_kG/aM_]bA5q;AYյBESZdm>6,aib!=N'$ ^gpzoXgQlr- :qa`]N&|-A[_E[|~6(uVbat W,a\t-9@rhC}B;IdQІV]^ZkKLkKs/GOճX:,K.T Z,?kDmHYUmՕFa4bj%! KKcbEo?}0.l6#BdO^:])&_Ol>v;d}-.ݎ ߯#)Di@p|ƷU0Af^Y|m[E3qN7h6<^*^8ln_ƫ]ZlP3Y" y|mynwmuTJ '9V-lR!X%׬XZB /: &E?ialTע[gE[U>rD &h~~/}=@9f [-'<#k2E+lEVuǟa "W ,P`_O?*Hv%u"2sе-䄅9TbtVag&A .ot2݉'d(4T?%+ -y4wbu}6^o& dt1݊5YaՅ kJP2ܥjϢ'ݳ(AY7r{|X EW7&šI EEܥ:ցR8](D̤xkvX$D O,a+VeX/CQ];KH_B>oLה0 ?|MaHFKk V&y>/]G~ tmY&g/Qzk헋{u<xkV :ڜ̾|d r; O vQ,c>7uPjT#lV Kُ5K:&9Ul>ʰ7X b b2  kv eAll]:=o󣓟Iӊ쀾EAؼ &w+4w kvց.Fbffpr|W;@o^-U$\ l^T l7dx(F~y} mTսk6/ ߀y@/;}TbcahEqaB4@ {}m\X95mӘ]Z+FΟX]yALuQ:JP}5lfA1,= p: 6mӨ(f[ kntLx\5GQ"Vgеek`/w:㪰)FE5ZPoP)|^:D| dS׶TM:P>\][ô|o"y|)]\0I͆g5ҾKې|}A2r:-)>t-ZOVC' Vsf-q5P.ژ@:$a]1 |-? 3m4)lf –[|A9L4]= s.aDurs5Cؼ =j7krTk^E`_+7dㇾQѮww1U&kΫ&rxw 7}yr tƟPsvI?Vu9אҵ{71%$hR\k>9F~_M{ {@e|j|*捻|mV4JJ+ sВk\Dp{[TC׬L4+?7UN[/S"Հ$g;x@6ǵrc  Fď,2#k3 }H;Υ/Nkifq#Ia5}eĄU c+ȁم=Apa!5ܟ D’W,acIBQy|7,A w@|.xCppR_–C׶D[x(٫&D24M4wcK3@rf] g.l L7~9\<$Z 5TmjA?M]L0e0 -\]@ t'.lt usIO"@Q_',IcxGNJSZMa5~ a[v?Đ5;8e_dma˩kvOrJ"!lkf( 5;?eE2/~UtٌKr& l$kN"@i_BеH5sK_J02zh 邘gZ a[n(."@q_ǿ ,X|DWפv>rG[ɤk)R( lѕ 5tnȜ`DgvX{Utmpn;*'oO(Xܙ܃䦄كFňX#I1/>-nݡ&EZ n [}/9*2o,bWn&O_t49B8~fmh*jY߰z/ꦿc Z9¶-S~CY~'еH2 l6 豝gQL6W)^.:'a˸M!_ex+% `YÓUㆰؔsc!Ǐ6N٣7GSA؂h#=]kágK1_6 r] 5zw$ 7 ]b`Dr5 ]9l&]]i!bC(B9_ҭ?еHBo}k_ "vcֵOšJ׬Z/OF5DC;t- z49PvBؾ7;ɅTuu'u[e[T0='\jI|2.3KI_-6y}M #bKG4_h*6]ܬVέdع|s6r5{^Jtc0)7lت56@Hb#=;Zoυ-Fѻ^RW}.(kV Z,–2:?w?c`}C|' Zܗ=;Zt BX d$)kd᛻t.t-::Fl2>>=NTRLVzTgGA؂`f=a%Iq_u# u 6 gյ-1RCVZ]sgxQ5Wu@ __=t 'a=au|#Lm ,jOeώd؟Pء$(xaKZ_Z>w[w {nՎm ܖ O+F<`:,8YkqБzA ltm֤潖;*_'q |ݠIy Ok.RuM.%qSt-q<$ԵO;SXǐ$C`% lѨkXY1T*Hhsls];:`SF@{YW1;}C:ش [ƅ `/񿏯ovYݵ*>o(Z3/kJGDu0ٜ= [j]*(YN 6ƣt^'6at~J_!'XPD|I]FGyz]If(XxmcƅD%ab_k$T6[ a0F\dM^sgZWؘW]Oy3_/=M] C*YlJ^0Mj H.2Qo6{(~zZhM*]i<%RL;p-O&{i8ԃ*s6v2LTcL^3"p6;PqLtK6jgp JK_R^]cHH׬3QUUp *ZұztDب{R :koU+cO\:fh3ipUb+~5$ r_K_"}q< I o֊J;4}Y;S. Rӝj aЙ&Zb5$ko:@,4?D7Ea2ItER|,<84Ѣ7Zu=lu{"^l)lDp&-]AhqCiwξė=$q#5SE* "q:(sq7 _-GXnk Vw͗}7=V3Q,x~\|u-8e*AŴ[{u_HvcHM@+ |mɝ.׉ar7ڌ:~^¶I$7==ciuƱ^SJwr`{qAU2hN¯dP fAl%t knG ˼$PmrAkl1j:1XuDr%˱ =#SϛS||vt8kG` HQLԐiy*gs@ RfY0\ת.Ao&."H؀ n_އwLG@gk [ Ķ;7$#SnD_RH"+=^<--6 18|۬9D_A% j X2cxoZ|p&zCjw1aon3ckzqNkDCXp&jH<>UQˀVJ5 6 -Ͱu탮sBa kDž>g;y?{iV&A%¹5ì@oXAWaAlc=QAlr}e-_X43Z[gk;k-@n\gE^n6DimU7$W0P:Mt//V֑Eʜn%>4/Xc~FE_7@fo_v9ٛqIJ{;_Y)eu5OFt:Q`Al(ka/d"lk$9hw2gwkj(hkW_bgj;\WDk]UaD3jcO\7R-S;M`Z;]NƬY5:/!Nk+HigfT])V =cxd|Z{jhdfK.uVұKd7 ߎYwÒ΍}MVqgbgt;*YCj()F1˩ؾXw'y4SS'݆8v?X56/*~rf?z-qgv8а:ygV%(syA1!W9!C\څb["7eXP [l 3_]ԡcX:[ͰJtGY*l~h|\xI7\}f1e]غF mHѝؾT{-qeíz="6 oZ@{3ma˦\+ n΢p6Bh55$aIT5NDUUN^#AmQ?N؍nc751O}emz.HkfoHPL`^K^6Tʮ;;Di$`.e+<>Xdtsnz.HOiNv (w`wL,D [}[DCl=}`l~wK_M1fig;.}Q$濍4;Xs{X*qQz,e79N\Rbl볕6 íZi>RLN~=@Z,_mݔϪ~Pƨ{j fVMg𖾚"x蚿HX&tl%ޛ66`'3imv+Ny@A{OU2!ֶ2.N|Tx4WWISjW3txVt;5Ear8񉊅8?lj(O F6-MoÌ7|st Vz(Ƶ)#+Xتq=x^/sZ'9}l>mut1 ^Kp헶$#"J}^[`*pdN@֪KؚSZ&-c ywt 0AF`rk0Inc̈vnג!NI.[K_T춬FgV.12`چ#TQkxaydM6( lM^zgE[cRЋu ʩƌkZТ?\S὎\'=Ôa鱙 Z}puغXyM4;fmҭo*[£Wb'ѝͶ[汈6 L"E+}ƦNH%pmRأLP8 $vqhteDb \laS7ol 窭cU^؜w bCP[>`HE\Ă_D`~Fnt6 ka5.d^y=S+GquK 6j".68> g:ޚ[r2go ׶Vukb2*5Ml7pKɶ QغV%k(D׶^_\ŭU2W 4/kA[Q/!&41Q%Q6t }H\cqb-X jl]k浂V_\-_ Cp6Eq4ѝ(Dsu> N7]嵢63^:ھ7 ^cE9GUS]4QxMglBMb*EUעDy|K>Xx\e 2 ^<^~Cۂ€ Y"֔s@~WUFV&Yv#” :h05 5E-ʝ]p+6/kIWI^3o7uy%kpmu`5j\#iSn! ϵ# l=B?) &.x i:Vyu>+Jy h{o&mBhoowmQ7\5Tۣ_%kh/, Iׁd~P9 n6y<_hϹzTHՏrE@?AlU5+)^k^iI~#`W3>fI^~!ۼy ]-ɍ/2V~D{vASKpC*Luw2M5EYB s+˒x .Gn% mװOrlk4L ct\֤Crے5Pt9g \5p 2m75γ kT֒hg2Y1^C$2Vݳkv. \+;׆qpGWvD=ެ pԻOtbpZns}+_ݎbSIZ:lؚqk@|5ISѨmp[Dл:0=#/H\?7HKQ{Wq\)(i,M YJFγ$&Ч*Z|ZFUoMtQO0eSfiWV T$ym6ራqMd{ÑhXafjs5դ.nP5˾7l^ptֽu\Gg8jpM +8Lz&#G4v ]s~vn=<*ml׈k* "˸\: 5}#WJ(n]]T HĶ5eZurB u\{~G`ǵL 1;P@c.b00A@^}ZtٵQFx 7)5`4YQss%\߁q( 64{>ajFGKdÚf)="S'oØkW0ovU'|;~`6 ;E+5^i`#9}$4vJk(k5|mKZ {q ^Gp&;/=ŸCpr͵\Lg͝G[*EpM] Ķe:C [5'\p=V'oy+kC N,0u%0,rx=+q7mF l׈hp=~'f wll9xM9Q\YK_$5Bcm#J!#ϦP*u\5aT{̓4F^mR ̋MrSwXK]oP,&]J5ynqmFCTlrN8Y<7;5xh t-} ~oUڸT,*dbWT^krkgj(*XK4!kM% L&wr=LR]`۱0+ `k>A"O5%q<9 pG7oQ2`)4nM,eD DϞwкx nC0eˎk~AnˊkѡjAw [)M?]GƇ͕ǯk2=hO%pMS0Q$^Gmur'®vǵ%A6fuޢC>qnN=m N->9k,k、s[U(XE4"B&~h[)vny~ YAǵeATbCCG X76t xktA({v;IUfd-`bZߠx ur4gu\[:&v:3י z,?(ۿeuDkq5MK }nYQ]ؒwo˸v=LK&"#3Tܧ] S0:P ?L'!󥭐1!אAV J  SmXѼɱX. G`:}8!#2Oz5P6C#$pJz_B.,m-5{s\wGS,u:96OhUGµHNeOr8O92`)?4@pQ,Im+1h;yKu7ֺ"fOiՔ"yMa`K.v?Ӿ=?Gwh vUi̠6bʌYkv%fmPZ,t{=_/ְx A/>0Eopv/Ll&+=pmicz??:"N<1-"_x_&Q:4HtnF߶x jkJ}?.\كnϏ1i;y^Lg,&f_"d cϢl]Q m&)1!p+ڶh@pmDi+^aAl ru; `4rv#l+jia@a—1\uM ?$yGSJvo#&JEs]A="lF.$?e$!,.$ҹB-ֵEڶpxc#TE 30bRo}~&lWR?4>Ι֣m]{x5.Y50v#15k;5Z6k/KXW[F,(C׍:RPmG[K({E ΆQd5F3 Vݸ"f$сY5=W0ղ"B|Ip-EzϣC<]r<^8DW B嵗?^ bk8:Υusm>-FtUP^"Nq6}O+嬒k˻'jfŷgrCAlI7o,-:W YyN! ˾x U[ܾh\ռ/b czD:É)3D3[Xw "@;'> ^fHE\S>c&k0w-k6k\AN0L&A*i`_)ՠ.5@1` [RLۤA00 xT=xs3O%U^5VM0و(,iL}q:Xto$-и.y u+UԶ":Zx.=5^CVCQn4aגkt:BTK/,uB' m޳7:0)\s)䉸 ͦm.`aŮK&]Fv/uȺހh &;߂=DuN~2r첻IwVJ+vi:9MZq #b[т°Rb_VmU6Y)k8$ I]ԁȖ`-R0}Gw;tWy k`q1& ̯2^Gxe6ⴛ_e`~H5vVXČjH8` _>'v i0YAQ3cr};}ي`i'&sOpG ai"ꗎ͘c6&%;yë -Zǵ&eS?9ҳ >ǻŒ qmdk80*.lIJgd9;z絎k3i6(ZS(oM-061t(qzgȀ$u\ir]<(uz[25%X68$~>wGL%7Vqہ\ݓz\}«HwUy^øfrT\> 0L?e/~V vy맜,M$x5zm+Q\3r+Qes{uvls5ZޡE6e C&)"bs-UE'u90PA9u%brxޖx_>ӕ)$)Ftf:,G,Bo k\-# Ąu`Sc~w@al'ڔx }B7K5]D bs 0;(KeXoi©kr<]ZǵE-^~\LlKϸ*]Iw˛OTܷ8Ώ^C ?zT^لT\SB[b AlӁ'?c?_K!a1B|5շW~}~7uŊdX8ciނa\cG|z$&ݯ׌WƵkD In+F$k /^3 ^5|O-D{SF6i`-x~Z T$cA~7 kjqԃ߯׷<>~s~Rlb^xcX!1 4x)תUGD~SS\35:c5uAE?ൎkaiZzf[ ,P\%K|fؘz@ZevỴ!y佇^ D7"k-S%5AzX5*lFr&{ )el= 2y [5>׳!~}8 ײ?(~FiBtH6 ֛ilraJ^:m|wuePp^?5J}γ%'XYQ&&TF&0kPKXWF^MC %WUGnzRDM6;ؐ#OV^l4Ӏe6S0pi&3,: R*y`wݕ?^C"&=mcB^'yf^G#O>kpE@6Nd ǂRfui%.0+^" m4/(@Tъ޼^aИv9\Y< uggy ѓA`?)~wiO"(@3 ^3[[m|>9-\x-df;07L62ӕ*yWqDS{4V8lZ"m uK71A; UpgֿbĈ;>)s -E*O$$cVŮ'X7ETvW'& [hF`ʽf1<-4dVp뉠 у3 [lȢ8YTTiU^Ciܰntf1OA=,`O!ٞ :Ux:#>x']9**6X#ZLRq]ktnp"x^qK``S(8 o>c[JF݀=TAkW^yZs{1p&6K6]˫K-5T:p&}Yļ 0}^^fDs!muȽ‘TfPQow)o0$ DiF$wN/Tl& # `}V8۲N7f):珇]&Ff,{ YU!TP*R52]CbkpNuLiw;)w+a/zJls,l ,i ^+#W͟kv->z!^p{I}1jZf#lGu)m6y|Dm5ssMК=1g ΘyTy-$G<[tKEolP)qRML^;7[X$^:^گ$0I7DW{aPHlѸr;Qj'H[y#m+p0igo¢@q>1٠U+TzW/f/FnjS5 icmIbj14_cӷA(.? 6Ie%F>9sܮ)'Ԥ|b\᧚RQ /ظJ`cʽp?ԛ4Ӏ3D(``#aE 쩉Jk̩*+ե׌D[> sg-rl Y-#U d 4.n^l o}%yu㕖%اJCoܲhr \lܮr {BrYה*璀![?;ko)`Îۅ4oeIqM"  ֶqnZo^+Wڼ~9uEnf$S<8,,5,5$)Fл=N>4l١O>>iu-CWu^[_+W/?+ӉnյWie %'2g0|/l=Pl5A8SMC?kFȽ7S6 EUGIؒ/NpMw&UDڮ: <7n[j^ F=&Tbk"_DxT{!+l˿wEbsq[rh StS'Tu6'pBݱ~'PXᡬxf:(m#(4Iˋ^BI $GcWk3 0B8F*:,kDƁ {Xya[d&%wd=K[/J/1 bp~!H-LQ-n]Ou^ :|XH5(FڈA~3XpD8OF #2&3i*5aO{G( l?y^T]N x<*[bټK\& lGOE4[*Zkv}vJV;O]SpVbנ8G,}交IY-f4JWw%UXϓ]{@ypR-a`嵌nV5bFD&5|TS(ӏJ)l346|$)mW+3rAlyO[FyBJ5Yx*}xD+mSogkSd$T%-5b"ky}IŴ{`~qoT5&ഊ8m/Qpi!D0e4 ("3Al)17Sޓ@^.D&e$M dY^-X՛ɋIאBts!^` \[6N5@ {$knar+}5Gx-oX'Ҳ Pei\CzPݥ+NאBwY"x4{'yy{ DDEAIm j–Sh ĽO%Q~ѪnؤP:Aųǂ[p ^Lt T]gËFC$P.XB\_h3oQȟ4WاFbQ;5(/|P'ԁˡJl0 L9  W wZL\,N.lѝՑ890tF1fkOĸv`GW ͯP V,e؀J$¬$x}Hu a\Kw\2v(Rq1Ѷ(|x˼"IPk[@l [1^Lgc"<~~t.j<>3Z@[ . xzY-A4a^pY6yo#_0𧙬O:LE󁄋IJY(9MϙqDq6I[8h*!ZmimBkBtզOܻ5+ZP k;dsfsYmhükzd`t`4RnkRWc~#P*o+ %v/%%SLF]^KtAwOG=Zw^~_4_Ն%%kRdTol4mU׭O|QmRo`~ȾXFs6l߸ I/+HW;oG/}F5u;a^+9G' SG3t뢢- SvkɎ p?S%E,@`;4l㗉.?d3<~๴ן &784g@䎵iEЕ6kɸ,@ 64gj%y"}*+8)ߺWwk&W^I,dk4e4(a% b3mނka Gbǫ-s_ ܖ EDxvĝCSamGW-[g^V7ܻO6kpD?@A ~X\e$md8rF-+9r=:~ Ժ&I1m0"ohk(H දZIV˅Bo,;ei xuz~|^C͊>75,?!ϡ*yMfnR6uʹ } gtԲ?TLhL]jM!QlL-Tzӱ{!NU;Mtl3[LHI5#dRIyЧؤ-^˭?!\-NfӬN#Y\BmkFZu)bxkЉ%xmTdO _VЗХ؄)^S+ 2ߋPk'&L l||tpbEPP 5*dKHjU1eKH5KV.p:92 vkٸbvtxVG4NzIrúcymy-?{ O\P嶁JnbՆx-@\5f5-=WZά:ט߱\yT[0[揿 Yp?~'143MQ {,[c* X2cW`]5\SK7xk@iEfAaخ)Kά\̕y; NjQI}'-4~J:d 0鎬6k,Vj$9#"cqd_&x1o0PH= l^8 j}2P0C˿sMʶŁ8E/,Bί26^c5!PpYeJX0X6N1~ǰ7\~̋Pm4N F^]\Qe ^j;26r񳦍O3% l1+G ed0ǟƯxڡpr:0 qc=PI%[Jj`ZvQW˘ZkLSQM.Wdi~nt3ۚ=V{('HH86sT0qӍr;A!mhv5pnHV),Q0 txKj,xzimA+*EMl5~gMh@I½kp0F zьV*y`SQw^jױdh1Y9F^cm;ln^SWx .,OySRأJXp|USҨhw.UZrGB=Bv4uL2,۹. c;UPn"-KDA(]H0"e#S 5J-', nˇ.  nFtSriLI-WW55>p|NGVpl#m}4fThLM61Wm Rɣ;{[P PI Ey^3w+q6utOH$E|?Yk1~)J8( =JQt$G0H(^bfIâZ5F\1e(Q)},hY0ӺmSDa:a,$\;گ7l0 [% 5kxPf]شs6$+]`pޔY):<Ꮆ2+yx B&doU `꘨m^;pNpa/e@;]j_m`\B~q93kdVO@eE3ju c/RIa]4[% ó% m?u,L՘ct;tz-بY)#j}.N^Õ6qe 3~9 GF+hLLl̓Hjh]BlXn}/SüƌkT4POwE/ HPj h<'Mm4D.}122zAЭۣUqRpNmT/PcyH JZ?3]W=.l!q^DM%( Vm` 1$ܣ ܗ6T#T-Ucܺ O*!`c5b,MLCM{C-bkr}bP)6ш:R붜 zk\$y817ߟi9Va\Je |sگV&kx$ FLĦtnʝm6S w|ymo3d{.,JZT€[jdpmIPF*Ҧz{μ6tձ9=H${T#^O qe` ʵ4QIɛ ܯW&ԗyhbV$X0{>ub]OAj_y Qs֭GLsvRǰH(I"<`YEUؚ{<5!\kOkӫO&Bl[||>BjOΙ]5 M@$5}̘uVLr79^5pm2kx?;¥˲'t1?_"=%*lѲy!nD~|_N $Ϩ5^5l+LQwZCxíj㙦xEy  @6,v`gJTh9? mʹ\ջ-1^ƌUVy DyÕy{s{1F}]9f Av-2RJ5B {eCՏ~KP[q{#1knZ$a[{Γ<4$KqVGo.Ψ[bTGC?yrگZI)^5D0:ꮾt|t53Ew' ږP- ]: 17wv$^`gJFARCJfiiAY-6⚡v3:KC~﹐іEo@mVpVAv%Sqsi6)V`iHEpZ(M4etP ܯWRCqM-{ )"WpTmޗ4>P)klr:U,N`a \%,Όe4:-F yC{5$y ˲l` [/^Xgk̼vJ5r wK [^tߧ<ޡdg yCZL@\4C8!J#0}%,gf` [CG{F9Fgsl ;ZA@wF {d~] OQw&(ч{x@׃p'U[S/|M^C"Ij(z?%Vz-L^"`+Vy/KNYr]#v>HN]?o*[̟w5Sf[5R6xڗ.,qwo5kBA {<'شd#1IK=tւ-!Y $ D1iW>p>t~UFRzM0T{C}˯}HO%B:8#C>QTacu|$Q|]bqG-^F7|$;-{C3_<# <N*K w#m2laݪ6'wgؚ%xDLxy-T)0Lpv[7TP- X[+&vJ=CFe.O ?^+: |IR6^xjmCMP--pM5Ft o>+P&m{9^`w`kAFvk^.[JcxœѤPIk)hװO4>]@mJb8ݯ?agV&y+`D ^.L,L U&4z 4&=Q5Zf+(a{ wnmTR&[tQRr`d ^*Ibq$A`CPl,y ڢE5w1ڹ9` bXZ(e.[G{ւ8cym+ר`QHr,{.Jo勩v^&QU,?A^YvFeyR?ЯA=t>ߥ# l׸Ip(aP3zʸMԹ }G[0yx 7Y h*lmq5e=D\ y"Ky3׳";/>gЖ!V/7 k}[<8Ajw*QcgE1#q`nqKX^F':w$M_!zym/7 .W*CdTV;Xژ68/Dϳzu'Mdm.;Jub[9rۖ|Ѵ+e*UjU.7*k}]u&k`PZ}w鸦XeP{ h6[!KL"kWO2l% ۫ZID=@CX-*kP)I?I>Oon.4}w?FGqme"\C[Jw/$u+R^ X*2\e EMyEgH5~b5 [p0bĵx+yI]Ō hf?,ˈTwN^{Ns YFSM \)':n wI<2ˊ0VZ|D[3׏iڕZޑD:1^EUK`[tZ%P\>ڜ`63C$,%DV$#Y 5Ιj_8;GͲi' 4,FDߓ tT%Ye ih[0Bu9AphRQ6'?AQ8%RᲩAu^#f Wkw<@PN<! p]݄j5C Ymr_tD`j2I)Ѽۏu[ĶkRl;`v=?>􆐸ClV*5pƨA&7J Īx n3p߳Gn(ZΈxR{c`ԟCQ DKW<2 86x 06&sG)>k?G8}wy6$yT 73)Ed|+S@st_gkb@Q-ZcSu;5f.b ᚼ_/tζCnz']qvSS7;&5Z5cNk޵ɮ{UdPpB#^x@jC[JuN|F5龊khF΢ۥ MlQlf"m(˼+2zD+˭Rm6E߹?2?u!h#L5ͨxxt` 讉m66[a /q8/ŵK:ݲ|9ܿu8L08/+wI2^L]>?~BO3!Z V)Q!`+`lb;-+7^V4C%*g9r&yAd3Pe;Nf g㾟wyR\{ DyRi\SkO]:HŒ$ZQq%s?3usZYqU^56ki=br̞|: 5SkW8p, l9J\<ܾÎ 4kEˠ 7,U[c2ْ_:+NeQM/GtXxB=2dfزx9B]VV8l^^#/h!֖%LH|vwx,1*kyh"^P]?sw|z4 p9V(q؈'hWƅVj/Gq|xx*Ra{2miJK~`RT5't،U J%-= Dͬ,K)kcY y|vR)}hI cD#J#DvTB@j/iFRbR*W+JGmb*-<6k׊KXDv-E1NOkZR8] C tU ޗRp=~G~vNG\:"wrV֍?זjװSt?@KwV}eO-B4i9N1 +tE}FP D/Jx ^nmSJVAdpûJwEAP~ GQZ7 n%ILF1C]ր.ˢK2> >jZ؃ց:QŮJx Kp=GՀ8~t6& w!WBd\KP1WZ6׹QfB]YIdg׺L4?yqhkVwx?9ڳlD.[;t6L\+ lbM4y'Gc/0Srk\D cٍyd>^!Σֳ2EnOwvEa|2O:[a6aQiaTTˢr-8siO]Oy fyBNi;9"ky#5hS?!PXKۄlZBӸ\}s; g}'*&]5RX F%Q`Hy ] Z)ݼVBx-Nbq93P:ʣڶŁ-V272vΈweWZCg D׈ Ṳ&ڣ 1F,Pm2k<}=~Fu!mh{NDRo>6燼xnW s?+)UVQv=?bֲyT~m 3C=KܽO=衈Ze]OJ;_7Q{ 2J?QZ.gV\wq.w\ޠQέwh5[ LJ 가iXyy0C<=cFC.0 T&OydKB_`Ul-zu^3`|iif0m%g;D (!I_dB,rq4a6'l[j0 <đ~nM67yB}>.ׄ1Nx v mЍX&jU^aFyThޟށMhJKrYj']~gfQ)#In<:k`rk$,5ٜ y9T>-$i\#{ a$wh jq|ɝ,_~zV[I-،q0u֚KV5U^[Y^6NA5PQ)kiFXi9{Q߳-/PS)>l*7@o׭%mbU(Me]Ƶ$"9>C6"Kx-;E݋TDz`e^Pf]܆7l=Y4e4&Ÿ))AW%:*2xt6xӚ SZlU细:Z[czAIi C)< xQ o嵻$e|^ ]#4-`JKGx?Xj?EeP|߬/}< ƿ<$l}iA^[^ؕ0 gq!p;U GxZbQ'J2JĤZ٦ $ǣ'=^[>#$_l3&76;t3Um(񼩔kM\TUQ<-3I&bc:KWx&mIf{cUx6 5x(~ 7kiu=C{ *q~2{6O|v -O{ə_ sip@H]x-(VU6^C[vmS'_ _3ٽ*i]YZz^mr %N7ϽQ׉kʟv9(^k$zr! u#ၖ4ZX}ڋ'>ZsC 0d۔=ߢL݃kG+v9}a kZ>`+RQw*~^ս 'Mp䶍=V0 5"/h^UM >kQ)a td-i!(FCyj]ͧ#2>\~ѿ3 W"%ƿjv&j*(j@x͋kP&b׽ sc.,_"g?µzxn nZ琢"D[BOxˣ3|ႅT׸}uyCЍq:[+F" ~R膙XffP#[iͿA|F0ͮEp!OrnCvx VzA3MI)GV犴3~5&#8Áqʹ<L`uQB؁!=ڞbNe { BbPlN:Z+ĆB C(p7q,!(>-i2xnNJZhpbx*}xt 5VB&E'#h[l. 1xp_[@>|tlNKZve{>OB{Upt]1[i{tEᵥ,47YUM5\e hGl dNw ^VD(ئދ 6] tK 5k45s7?EBl8C`?VWO4 4%c>~ɽ !V,4Cos?HBn^)6Skz?ൄ '6f{SŸM)f~ 0=tpQT]jZ9gpm!dxjlBQ$X`̘kVUpMf.z&:`IYW"E%I >Q7UˡtթIȃMnJ\N67tE~‹6vҼF^)< l6~eddq,DG\]\R*,0K`l+_ Ը~ 6dkT׈k^31kp2 A1M0ފUquj}Kx mUD 8ɶ1 MݼfVeyiNh|E`c 6"Vm{+~,]_8][mD#v^jn( jca+ SS3y_+" Vx)/>^Tb}z#sUk$80<4zikPX<& pQNthE~0kz=5h~zcTC-?l'r\#H>\yֈ%nse~.)?TA5r7pLAϑ 'b)4`w!U ^g;O~"v1yWɼ^Kz@x-otw*gfwUqR,1l, W\<'ƸSqÃL?̛~ٳ ĸ-قО)൉EjIUl2y蘭JlřAt]CJ.t kB)y8?5تhIzRVp 7^M _!UWj+ 2B] :_tT(5wQ ^&11ryO*^ _wAzq3MqZܴՊ뻹ӡZXUO0]*:ajqx k93ߢj&J O7xbKj .{}ݠ"C{(?g)T9yͪy M6Y9keZk {YDRk$N`qX5.f%~ƿU.'OZ] +8j6*e^#k3¹ظ5R7xE5dӠ$dHnH.%`뼶e=+:(y]25ۈQlRFצ:g*=jL~3qLA‘&8-q6/ [6'x^ߍO7VӔ- ݒU,㭹J*]^x2=tPZ•|F|iznЍ `Wvb$\j Bٔ5zm~*ΘJHܴ@U6y^|dUgpn7~aۥ{﨡DZ)'f_m H!>wCkO<!gx\1&oH]|x_aTq ] J{־•\8 Ř#x5z5۸x l:iK[5;~T?Uro;2,6k^:wngojċpELUCMH,ԟÇ9.G z]R56KcO\mö ~kxrچpE uŶwQ ro 񱩅 8G4ސJ"-^0':WFW[ C4z8FWј.6.n p[}e9Ύ!6u3':-e'uv4ͮc%&-^C_+ntH Cb? Hj9o8`1*>ykF*HV{bB>A3"-AKՀE\a jnMJF/ tYL}dGy>6RI7(^|@c[–#Sn'6]Hv8Mxg2&8Eu#6 QEZҜ*t-/d+:051bN gC"s[r9u'B\u+ƁZO!l&7+^#Z>FL(׿Cmɽ?B5TiQ\.Miƈݢ5u 7Ώoq-D\KI lԭkMeUw ADE*mNTἶY\#DjΈ`9Ph6 _sDQDčX4fr t}56Z#oơ>wK}<;chla\ûxh`NEaBճ§AzA?ϸ E<|3K[y)XkCWH<=~Mb{ 4 ]4b?X&MѮhj,w[nɚw47zw+t|ΊpPrlTFM 7Omcg90]?PAq=FdDu\#ݩ~69~dut  ʊaqxr<@ug@-(8 Jc&%k$Ge .- g^װ.~kHɔ^; Ea |=6a{ M;gkyT q^#1 [ 7år}8ZL(z? ⵎkOAqQPc$B ,^su=pPD,gh̕VKIҼv1 0ZP,_DrF<䂂"ch _C6^,=w\Wfü@n%Z&*Q6(ًqL#4႕K1[Op9Hy( [ൎkЩD_cL\UVr~`3{#7SaX| Ƣ:[0z ̘иx+}&Z%ѬҦk׀W}ǣM*ɮx x.FtGY"O\m柑}O/BFd-q\q8Vx\.)GZåxVyRYj` ꅭ ]$BxEO?J [+ӎ%k- F _viQdu\BAl#;Z8y7\N^C- ZjP4#OᑕLR3;z %kҲv7ȯ;)*f-6c҃:RfcDVuSfgǵHn&MBD@`|x2HXyw2(,5Jv&L٘$y\AGd| nV5s _E={2u\0גj4huXq)&w^^CkmڡN<$n@r=,Xˣ'"A^#k+S 䜴|#9^k+}YUi l>"u\_I +Oytek @WG#UE%>݊KH5A5<' Y }:y5RA^CG\aϫ-'5)v^CC'&G"tV`/9)k,?^Nex%5!bMdoNWdx~SམߝvCجQ}V0cOԝ$x;7N,.ʂM^la=1ZqXP.p&%k$54 V/JeeH0Yy#v[d ;+zgz1/l-ΏϻRlۓ jS#hт/$u! ض~g8[q kziX{]cl-k5. 3S,ID쎍U TmEmJȩ2*$`(L}p$5k`2̸NV`ώaLI jtPc<4SҒjAO$`sxIhn Uṣg~nǵu/ ,Y(5\nrv"P4G}K+ńڵ$^F0΁{{.FqP3Y;zSƣU[\(}f* a cV <^5lEpLI3Ak\;db[nQy ;e SF%8[ y{; 72Zk- CIXlP^GJR{D$'.fԡpM:Ou[DM; m׎kH,hH#ʀί,\v$^5k_Ӻy8evC6y9elMz1%o$+VxݽK098R#+l rM$k``[rM&6ݾyI$ $V,w^L25ܖwڨqm]Hdl8\P$sH͹5lz bSg1-ݼVxyd>)` lJ$ M!%eTfB1OnZam83G Yeȩfp8=GW6&6g{׬Xy.(36e$6^4cb;<·k8 *-t%cT_?r9a% % Rrg'W hE-q*\ЏmDʯ=dI;8GiǵyxjKE.j{Jy n.9*b!QlݼVy_=O9@x-69¨:yt١xC}։}`K]G]T7jEm6ڪxm  C*#LdYSY =Jel E65H/ kyך މF-TOၣ lgd ܽ9'Y)y6ȴTx7b6ql(gX1WkIek8P`s{o#pf'n 3z-(Ws &5Kae;Z:lbYjkU43@C;j,HDy-ؚO5mFs%(BѬj&RP XMW }ݼVxDSZR K Rp'gc)$l#\kphk'l{5Z5r]Ulc95[4˧~/xS xءe>*ҒIE]\Ux-lwd ^4hf )^gMMW&u`k`Ln(%q @w8PNy9 ^#/(4tZb5k{D *y}9?|QwՌ W\rT,!=o?{wߛ6W/UqŨh+J5U.X˽h>' NMo{\l v(hAG>_4] [Bv&# cʙ[˚9hh%M>:M$} VTh[k*׈54!Bs,Rڨbk 6m^||EbPJbo,W`X,]a ,+UyFr .(&iR67{=+A>YI*F ?@_k9`` qƎs@oM`Dl܁Sx-?׀|H0Bvn#qW. u7گqJ$a7Iu7ë/֬#8/r)R.o#?n<*2kκFeˤ6B`4[ʚ\]ߑEU(8c> (o9f9EIi-U8HbZ9Fr R=R`wSf*ҶxBפTo (mR) l IXcj & M-?G(ZFr RWlɷ[vϨQ\uqOhUft6KI5MMUY`C{׻_(_˾E/g{SZu+Xr ~"+F\s`ڐfq=mp޷68AI`C{Tx3 }{ݼt*LP\%lPy$O6 |7x툟hRhɭ6;@<)UprM3I2/5DiRnĮ]ɼ5նl D7" t_Fp6߼՝Dp6‰ŀ ~mR,Nwn&F |׶7J]2ƵI v׊Rxy;듘? #5 g [vK?>ޗl(^C|od{;]},תVM "Q\o/AdB|>KWV@oHZ;ZXpL+̃tY|08WT8o:ƑM [eyQnz.#VjJ歽 [P|j_˿tla3|U endstream endobj 29 0 obj <> stream xTvp~`pUfPbFX@S0E 73(Y:w endstream endobj 30 0 obj <> stream ,Photoshop 3.08BIM,,`hhttp://ns.adobe.com/xap/1.0/ image/jpeg Print 2017-11-13T10:58:17+01:00 2017-11-13T09:58:20Z 2017-11-13T10:58:16+01:00 Adobe Illustrator CS6 (Macintosh) 256 228 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgA5AEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq4mm56Y q+XPzn/5yW1STUbjQPI9wLazt2MV1rSAGWV1JDC3JqFjH843btQdQr59v9S1HULhrnULqa8uG+1N PI0rn5s5JxVD4q7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqi9M1fVdLuRdaZeT2NyvSa3keJ9v8pCDi r6O/I/8A5yQvrzULfyz51mEr3LLFp+skBW9RjRYrilAeXQP4/a8Qq+lMKuxV2KuxV2KuxV2KuxV2 KuxV2KuxV2KuxV5/+fPmS68vflXrd5aOY7udEs4HBoVNy4idgR0IjZiPfFXwlgV9O/lx/wA4q6Dd +W7XUvN1zdHUb6NZ1s7V0jSBJAGVXYo7M9PtdAOm/XFWV/8AQp/5Wfzaj/0kJ/1Twq7/AKFP/Kz+ bUf+khP+qeKu/wChT/ys/m1H/pIT/qnirv8AoU/8rP5tR/6SE/6p4q7/AKFP/Kz+bUf+khP+qeKu /wChT/ys/m1H/pIT/qnirv8AoU/8rP5tR/6SE/6p4q7/AKFP/Kz+bUf+khP+qeKu/wChT/ys/m1H /pIT/qnirv8AoU/8rP5tR/6SE/6p4q7/AKFP/Kz+bUf+khP+qeKu/wChT/ys/m1H/pIT/qnirv8A oU/8rP5tR/6SE/6p4qwn81v+cX9F0fyvea75UurkzabE1xdWN0yyiSGMcpGjZVQqyrU0Na+2BXza CQajYjocVff/AOUfmW48y/ltoGs3LmS6ntvTuZD1eW3doJHPuzxE4VZdirsVdirsVdirsVdirsVd irsVdirsVdiryT/nKT/yUl3/AMxdr/ycxV8W4FfpNp/+8Ft/xiT/AIiMKq+KuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KpL52/5QzX/APtnXf8AyYfFX52YFfcX/ON3/kl/Lv8A0ef9R0+FXpeKuxV2KuxV 2KuxV2KuxV2KuxV2KuxV2KvJP+cpP/JSXf8AzF2v/JzFXxbgV+k2n/7wW3/GJP8AiIwqr4q7FXYq 7FXYq7FXYq7FXYq7FXYq7FXYqkvnb/lDNf8A+2dd/wDJh8VfnZgV9xf843f+SX8u/wDR5/1HT4Ve l4q7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq8k/5yk/8lJd/wDMXa/8nMVfFuBX6Taf/vBbf8Yk/wCI jCqvirsVdirsVdirsVdirsVdirsVdirsVdiqS+dv+UM1/wD7Z13/AMmHxV+dmBX3F/zjd/5Jfy7/ ANHn/UdPhV6XirsVdirsVdirsVdirsVdirsVdirsVdiryT/nKT/yUl3/AMxdr/ycxV8W4FfpNp/+ 8Ft/xiT/AIiMKq+KuxV2KuxV2KuxV2KuxV2KuxV2KsL/ADD/ADe8leQ40XWrl5L+VecGm2yiS4Za 05UJVUWo6uwr2xV5m/8AzmH5SDkJoN+ydizwg/cGP68VS/X/APnLPyzqehalpsehXscl7azW6Ozx UUyxsgJoeg5YFfMWKvoH8rP+ck9A8m+Q9M8t3ekXd1cWHr854njCN61xJMKBjXYSUxVlf/Q4nlX/ AKsF9/yMh/rirv8AocTyr/1YL7/kZD/XFXf9DieVf+rBff8AIyH+uKu/6HE8q/8AVgvv+RkP9cVT PQv+ctPy8v7yO21G0vtKWQ0+tSoksK/65iYyD6EOFXtNneWl7aQ3dpMlxa3CLJBPGwZHRhVWVhsQ RiqrirsVdirsVdirsVdiryT/AJyk/wDJSXf/ADF2v/JzFXxbgV+k2n/7wW3/ABiT/iIwqr4q7FXY q7FXYq7FXYq7FXYq7FXYq+AIl1n8zPzKVZpxHf8AmG9oZZKssKMdgBtVYoxRR7UwK+hU/wCcPvI4 RQ+tamXoORBtwCe9AYjT78Kt/wDQn3kT/q86p/wVv/1SxV3/AEJ95E/6vOqf8Fb/APVLFXf9CfeR P+rzqn/BW/8A1SxV3/Qn3kT/AKvOqf8ABW//AFSxV3/Qn3kT/q86p/wVv/1SxV3/AEJ95E/6vOqf 8Fb/APVLFXf9CfeRP+rzqn/BW/8A1SxV55+df/OPOm+RvLUfmDRtSnureOZILy3uwnP97sjxtGqD YihBHvXArOf+cQfM97eaDrXl65kLwaVLDPZBqnil16nqIPBQ8XKnixwq+g8VdirsVdirsVdirsVe Sf8AOUn/AJKS7/5i7X/k5ir4twK/SbT/APeC2/4xJ/xEYVV8VdirsVdirsVdirsVdirsVdirsVfB v5F/+Tb8s/8AMX/zLbAr7ywq7FXYq7FXYq7FXYq7FXkn/OUn/kpLv/mLtf8Ak5irzz/nDX/e/wA1 f8YrP/iU2AK+nsKuxV2KuxV2KuxV2KsE/PHyvc+Zfyv1vT7RDJexxLd2sajkzPbOJSigdWdVZR7n FXwbgV9Iflz/AM5W2GleXbPSfNenXVzcWMawR31l6bmSONeKGSOV4qOAACQ2/XFWWf8AQ3v5a/8A Vt1n/kRa/wDZThV3/Q3v5a/9W3Wf+RFr/wBlOKu/6G9/LX/q26z/AMiLX/spxV3/AEN7+Wv/AFbd Z/5EWv8A2U4q7/ob38tf+rbrP/Ii1/7KcVd/0N7+Wv8A1bdZ/wCRFr/2U4q7/ob38tf+rbrP/Ii1 /wCynFXf9De/lr/1bdZ/5EWv/ZTirv8Aob38tf8Aq26z/wAiLX/spxV3/Q3v5a/9W3Wf+RFr/wBl OKu/6G9/LX/q26z/AMiLX/spxV8/fkX/AOTb8s/8xf8AzLbAr7ywq7FXYq7FXYq7FXYq7FXkn/OU n/kpLv8A5i7X/k5irzz/AJw1/wB7/NX/ABis/wDiU2AK+nsKuxV2KuxV2KuxV2KuxV81fnN/zjNf XeoXPmHyOiObljLd6ISsdHO7NbMeK0Y78DSn7PgAr591Dyj5q02Ywaho97aSgkFJreVDUeHJRXFU J+h9X/5Ybj/kU/8ATFUJirsVbVWdgqgszGiqNySewxVFfofV/wDlhuP+RT/0xV36H1f/AJYbj/kU /wDTFXfofV/+WG4/5FP/AExV36H1f/lhuP8AkU/9MVd+h9X/AOWG4/5FP/TFXfofV/8AlhuP+RT/ ANMVd+h9X/5Ybj/kU/8ATFWYfkX/AOTb8s/8xf8AzLbFX3lhV2KuxV2KuxV2KuxV2KvJP+cpP/JS Xf8AzF2v/JzFXnn/ADhr/vf5q/4xWf8AxKbAFfT2FXYq7FXYq7FXYq7FXYq7FXYq7FXzf/zkD/zj 99Y+s+b/AChbf6RvLq2kxD+87tPAo/b7ug+11G/UK+YsVT7yD/ynflz/ALall/1EJir9D8KuxV2K uxV2KuxV2Kvz+8qalL5C/Mqyu9VtnZ9Cvyl9brs9I2McnHlTcCpWvXAr60i/5yU/Jh41ZtfaNmFT G1nelh7HjCw+44VXf9DI/kv/ANTF/wBOd9/1QxV3/QyP5L/9TF/0533/AFQxV3/QyP5L/wDUxf8A Tnff9UMVd/0Mj+S//Uxf9Od9/wBUMVd/0Mj+S/8A1MX/AE533/VDFXf9DI/kv/1MX/Tnff8AVDFX f9DI/kv/ANTF/wBOd9/1QxV5b/zkH+eHkXzP5MXy95buX1Ge5uI5Z7j0pYI4khJb/dyRszM1KUFK V3wKjv8AnDjR7uOy8y6xIpW1uJLa1t37M8IkeXt2EqYq+j8KuxV2KuxV2KuxV2KuxV2KuxV2KuxV 83/85A/84/fWPrPm/wAoW3+kby6tpMQ/vO7TwKP2+7oPtdRv1CvAPIP/ACnflz/tqWX/AFEJir9D 8KuxV2KuxV2KuxV2KvKfzW/5x78tee7xtWguG0jXmULLdxoJIpwoAX1oqpVgBQMrA061oMVeXf8A QnPmD/qY7T/kRJ/zVgV3/QnPmD/qY7T/AJESf81Yq7/oTnzB/wBTHaf8iJP+asVd/wBCc+YP+pjt P+REn/NWKu/6E58wf9THaf8AIiT/AJqxVI/PH/OMes+U/Kuo+YZ9ctrqLT0WR4EikVmDOqUBJp+1 irxXFXrX5cf844ebfOehjW5LmLR7GYj6j9ZR2edO8iqtKJ/KT9r5blVnei/84cuL1G1vzEHslNXi s4Csr+weRiqfPi2NK+h/Lvl3R/LujWujaPbLa6dZrwhhXfqaszE7szMSWJ6nCqY4q7FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq8L/Mf8go5PO+j+dPKkKxyJqdrPrWmJRVZRcIz3MI6Bh1de/Ub1qq90xV2 KuxV2KuxV2KuxV2KuxV2KuxV2KuxVgH5+/8AkoPMv/MPH/yfjxV4V+QP5Av5geDzV5qgK6CpD6fp 7ihvCOkkg/3x4D9v/V6hX1miIiKiKFRQFVVFAANgABhVvFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7F XYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FUBruh6ZrulT6VqkIuLC54evASQHCOrhTTehK iuKo5EREVEUKigKqqKAAbAADFW8VdirsVdirsVfnP/izzV/1eb7/AKSZv+asCu/xZ5q/6vN9/wBJ M3/NWKu/xZ5q/wCrzff9JM3/ADViraeb/NiMHTW79WU1VhdTAg+x5Yqyjy3+e35p6BMjQa9cXsK0 5W2oMbuNgP2ay8nUf6jDFX01+T/5+aH59I0u8iGmeZVUt9TqWinVRVmgc71A3KNuB05AEgq9VxV2 KuxV2KuxV2KuxV2KuxV2KuxV4X/zljres6T5Z0OXS7+5sJJL11ke1leFmURE0YxlajFXzv5X89ed pfM2kRS+YdSkjkvbdXRrycqymVQQQX3BwK+/MKuxV2KuxV2Kviz89vOHm2w/NjzDaWOt39raxSwi K3gupo41Bt4yeKKwUbmuBWaf84oeZPMWq+btZh1TVby/ij08PHHdTyzKresgqA7MAaYq+n8KuxV2 KuxV2KuxV+aWBXrn5K/kbZfmLpOo39xq0mnNY3CwLHHCsoYMnOpJZaYq9G/6E30j/qZ7j/pFT/qp hVbJ/wA4baYUYR+aJ1enws1ojAH3AlWv34q8i/NL8kvNX5fGO5u2S/0ad/Th1K3BCh6VCSod42NN tyD44FYJp2o32m39vqFhM1ve2kizW06bMkiHkrD5EYq/QH8uPN0fm/yTpPmFQFkvYR9ZjXos8ZMc yj2EiGnthVkmKuxV2KuxV2KuxV2KuxV2KuxV8/f85if8oroH/MdJ/wAmTgV80eU/+Uq0b/mOtv8A k8uKv0Ywq7FXYq7FXYq+Ff8AnIP/AMnF5k/4yw/9Q0WBWc/84e/8pnrf/bOH/J9MQr6xwq7FXYq7 FXYq7FX5pYFfVn/OHf8Ayiuv/wDMdH/yZGKvoHCrsVYt+aelWWq/lx5ks7wL6J064lDt0SSGMyxy dvsOgbFX594FfYX/ADiTdTTflhdRyfYttVuIoev2TDBJ/wASkbCr13W9c0nQ9Ln1TV7qOy0+2XlP cSmiqOgHiSTsANydhir5v89f85c3rzSWnkvT0hgUlRqd+vKRu3KOBTxUeHMn3UYFeVX/AOef5tX0 vqzeZrtG3+GApbrv/kwqgxVF6H/zkF+bOkXAlXXZL6OtXt75VuEb2JYeoP8AYsMVfS/5O/ntovn9 Dp9zENN8yRIXksqlo5UWlZIGP4odx7jfCr1HFVO4uLe2t5Lm5kWG3hUyTTSEKiIoqzMx2AA6nFXz z5//AOctrKzuZbHyZYJfmMlTql5yWAkd4oVKuw/ymZfliry26/5yX/OSaYyR61HbKekUVnaFR/yM ikb8cCp75X/5yx/MHTpkXXYbbW7Wv7wlBaz0/wAl4QIx9MeKpt/zkJ+Y3lnz3+XugalokxJjv3S7 s5QFngcwkhZFBPXswND9+KvEPKf/AClWjf8AMdbf8nlxV+jGFWPeePPvlnyVo7arr116MRJW3gQc ppnArwiT9o+J6DuRir5s80/85cecLyd08uWFtpdnUhJJwbm4I7E1KxLXw4n54FYnH/zkn+c6urNr 4cA1KNZ2VD7HjCD9xxV6T5C/5y4ke5isvOthGkLnj+lbEMOHvLAxeo8Sjf7HFXk3573lpe/mxr13 ZzJcWtw1vJBPGwZHRrWIqysNiCMVZ/8A84e/8pnrf/bOH/J9MQr6xwqwH8zvzo8pfl/EsN8zXusS pzt9KtyPUKno8rHaNCe53PYHFXz1rv8Azlj+ZF9M/wCi4rPSbf8A3WqRfWJAP8p5SVJ+SDAqVWH/ ADk7+cFtIGm1SC+UGvCe0t1B9v3KQn8cVer/AJf/APOWWj6lPFYecLJdJnkIVdStiz2vI7fvEblJ EPfk3vTCr3+KWKaJJoXWSKRQ8ciEMrKwqGUjYgjFX5qYFfTv/OJmv6FpnlnXY9S1K1spJL1GRLia OIsPSAqA7LUYq92/xt5M/wCr/p3/AElwf814VcfPHkpQSfMGmgDck3cFAP8Ag8VeH/n/APn55cn8 t3flXyreLqN3qI9G/v4Pigjtz9tEk6O0g+H4agKTvXAr5cxV9y/848+Wp9A/KrSYrlSlzf8AO/lQ 7EC4asfX/ioJXCr5y/5yG/NK683+bJ9Ks5iPLujStDbRqx4TTJVZLhh0O9VT/J+ZwKwvyH+Xvmbz xrH6L0K3EjIA91cyHhBAhNOUj0P0AAk9hir6G0T/AJw88tR26/pzXb25uSPi+pLFboD4D1VuCfnt hVhf5sf84x3XlfR59e8tXsup6dZqZL2zuFX6xHEu7Sq6cVkVR9ocQQN9+wV4ro2sajo2q2mq6bM1 vfWUqzW8q9Q6Gor4g9CO42xV+gfkTzZaebfKOmeYbUBUv4Q8kQNfTmUlJY/9hIrDCrwH/nK/8yrr 65D5F02cxwIi3OtFDQuz/FDA1Oyr+8Yd6r4YFfOVvbXFzcR29tE89xMwSGGNS7u7GiqqrUkk9AMV e3eV/wDnEvzvqdol1rN/baJ6gDLbENczrX+dUKIv/BnFUH50/wCcWvPmgWUl/pk0OvW0ILSRWytH chR3ELcuXyVifbFXjJqKqajfce4xVNfKf/KVaN/zHW3/ACeXFX6K3E8NvBJcTuI4YVaSWRtgqqKs T8hhV8Cfmp+YWoeevN93rE7OtirGLS7VjtDbKfhFP5m+0/ufCmBUu8m+RvM3nLVhpfl+zN1cAc5n JCRRJWnORzso/E9q4q9otv8AnDnzC1oHuvMVpFd0qYY4JJIwfD1C0Z/4TGleYfmL+T3nTyFIj6vA k2nStwh1O1Je3ZjuEYkKyNTswFe1cVYRir3z/nD3/lM9b/7Zw/5PpiFfQf5q+fIPI/km+11gr3ag QadC/SS5lqIwRtULQu3+SDhV8F6tq2pavqVxqep3D3d/duZLi4kNWZj/AJ0AGwGwwK9E/Lf/AJx8 87edrNNTX0tK0aT+6vbvlylHQmGJRyYDxJUeBOKsu17/AJxB812li8+j6zbapcoCfqjxtas9OyMW kXl/rED3xV4XqWm3+mX8+n6hA9re2rmK4t5RxdHXYgg4q+g/+cV/zUuYr/8AwHqs3O0nV5NDdzvH ItXkgqf2XFWXwIP82KvnPFXYq7FXYq2qs7BVBZmNFUbkk9hir3T8l/8AnHPWta1G21vzdaPp+gwM JY7CdeM92Ruqsh+KOKv2iwqw2HXkFX05521N9G8k67qVvRJNP066ngFeI5xQMyAeG4Awq/O7Ar6b /J/80vyq/Lr8trSG8vjPr1+0l5qNpaRNNNzLFY0L7RLxiVfhZxvX3xVDeZP+cxLhucflrQFQU+C6 1GQsfpgh4/8AJ3FXlXmj89PzR8xpLDea3LbWkoKtaWQFtHxOxUmOjsp7hmOKsCxV9d/84mPrcPkv UtP1Gzuba3huxcWEs8TxpJHcRjkImYAOFaOpp05e+FXzf+a+pzan+Zfme7lJJOpXMSV6iOGQxRj6 EQYFer/84jeTbO/1zVPM95EJDpKx2+n8hULNOGLyCv7SItB/rYq+q8KuxV8c/wDOUvkqy0Dz1Bqt hGsNtr8LXEsS7AXMbcZmA7Bwyt8ycCvLfKf/AClWjf8AMdbf8nlxV9u/npqj6Z+Unma5QlWe1+rV HhdyJbn8JcKvg3Ar7m/5x/8AJ1l5b/LPSXjQfXdYhTUr2anxMbhQ8an2SNlWnz8cKvR8VQGv6Fpm vaNeaPqcInsb6JoZoz4MNmHgyndT2OKvzx8xaPLomv6no0zc5dNup7SRxsGaCRoyR8+OBXtn/OHv /KZ63/2zh/yfTEKm3/OY+sSm58t6Mr0iVLi8lSvVmKxxkj2CvT54lXiH5ceWE80eedF0GUkQX1yi 3NDQ+ilZJaHx9NGpir9Bra2t7W2itraNYbeBFjhiQBVRFFFVQOgAGFVTFXzV/wA5feTrJIdI83wI I7qSX9G3zAf3lUaWBj7qI3FfCnhgV88+WdZm0PzFpmsQkiTT7qG5HHYn0nDEfSBQ4qluKvfP+ccf yn8j+ddB1e78xWT3U9pdJFAyTSxUQxhiKRsoO+KvWL3/AJxf/KWeznht7Ce0uJEZYrlbmd2jciiu Fd2VuJ3oRhV8l+evJGt+S/MdzoWrx0mhPKCdf7uaEk8JYz/K1PoOx3wKnn5NfmWPIPmxNQuLVLrT LkCG/TgrTIldpIGO6stelaMNvAhV90aZqdhqmn2+o6fOl1Y3cay29xGaq6MKgjCqA85aXJq3lDXN KjBMl/p91axgdeU0LIKfS2KvzqIINDsR1GBUy0Py15h164Nvoum3OpTCgdbWJ5eNehYqCFG3U4q9 P8t/84sfmdqnCTUEttFgbdvrUokl4+Ijg9Tf2ZlxV6p5c/5xE8mWfCTXdTu9WlH2o4gtpCfoHqSf 8OMKs90vQPyd8lazY6LZ2mmaXrV4hexSUKbqRUYL8M03KQksfhBarb0rQ4qzvFX57fmVaTWn5h+Z reYcZE1S8PzDTsyn6VIOBXuf/OHWv2wHmHQHYLcMYb63WvxOgrFLt/kn0/vxV9LYVdir5Q/5y/1u 0uvNmi6REwafTbSSW5p+ybp1KoffjEG+RGBXi3lP/lKtG/5jrb/k8uKvtb/nIKxmvfye8yQxbskM M57/AA29zFM//CxnCr4UwK++/wAndft9d/LLy7exSCR47KK1uOlRNbKIZKgdKslfkcKsyxVbLLHF G8srBI41LO7GgCgVJJPYYq/O/wA8a3HrvnLXNYiJMN/fXFxASKH0pJWMY7dEpgV7D/zh7/ymet/9 s4f8n0xCor/nMaxkTX/Ll/Q+nPaTwA9qwyBz/wAnsSry38l9YtNH/NPy3fXbBLdbsQu5NAv1hGgD E9gpkqcVffOFXYq8F/5y+1yC38l6TowcC6v7/wCscO/o20TBj7fHMmKvlOwspr6/trKAVnupUhiH i8jBV/E4FUMVfVn/ADh3/wAorr//ADHR/wDJkYq+gcKsF/N38rNL/MHy41nLxg1e0DSaTfkf3chG 6ORv6clAGH09Rir4Z1vRdT0PVrrSdUt2tdQs5DFcQP1Vh+sEbgjYjfAr1j/nH787H8naguga5MW8 sXsnwyMSfqczn+8Xr+7b9te32h3qq+x45EkRZI2DxuAyOpqCDuCCO2FXw5+f3kCfyh+YF40cfHSd Yd77TXH2aO1ZYvnG7Up/KV8cCpV+VX5paz+XuvtqFkgubG6UR6jp7NxWZFJKkNQ8XQk8Wp3Pjir6 b03/AJyn/Ki6tFmuri7sJ6fFbTWzuwPgGh9RD9+FWJ+dP+cu9Kigkt/KGmSXN0aqt9fgRwr/AJSx Ixd/9kVxV82+YfMWt+YtWn1bWruS91C4NZJpD27KoFFVR2VRQYFfWv8AzjG35i3HlSW98zXks2iy 8V0KK6Ba4KD7Ugkb4/SOwQNX2oKVKvLv+crfIdxpnm6PzZbxV07WlWO5dQaJdwoFo3YepGoYeJDY FeP+V/M+s+WNdtNb0ecwX9m/KNuqsDsyOv7SMNmGKvqPyp/zlp5JvbNF8x2txpN+oAlaJDcWzHoS hX94PGhTbxOFUJ5z/wCct/LdtZyQ+UrGbUNQZaR3V2no20ZPcrX1Xp/LRfnir5e1jV9S1nVLrVdT na6v7yRprid+rOx9tgB0AGwGwwKifKf/AClWjf8AMdbf8nlxV+h2raZaarpd5pl4vO0voJLa4Txj lQow+5sKvz285+VNS8qeZ9Q0DUFInspSiyEUEkZ3jlX/ACXSjDArLPyg/OjW/wAu72WJYv0hoV2w a705m4EPsPViah4vQUPZh17EKvoe1/5yp/Kia0E0st7bTUBNs9sWcHwqhdP+Gwq8l/N7/nJe781a bPoHlq2l03SLgFLu7mI+szxnrGFQssaN+18RJHgKghXhmKvfP+cPf+Uz1v8A7Zw/5PpiFewf85E+ QLnzf5AlawjMuraO/wBdtI1FWkRVKzRL7sh5AdyoGFXxHgV9Kflh/wA5VWlnpUGk+doJ5JbZVih1 e2AkMiKKD14yQ3IU+0teXcdyqzXW/wDnKv8AK+ytGk05rvVbmn7uCKBoQW/ynm4cR7gH5YVfLn5h fmBrnnrzHLrerMFJAitbWOvpwQqSVjSvXqST3OBWb/8AONP5f3HmTz5b6xPEf0R5fdbqaQj4WuRv bxg+Iccz7L74qwf/AJVj+ZX/AFKes/8AcPuv+qeKvpf/AJxT8u+YNE8ta3DrWmXemSy3iPFHeQSW 7OoiA5KJFUkV8MKvccVdiryT8+/yYh88aT+ldJjVPNNgn7k7L9aiWp9BzsOXdGPfboahV8pf8qx/ Mr/qU9Z/7h91/wBU8Cvov/nHHzH+YuniPyb5q8v6rDpqIx0nU7mzuIo4AiljbyyOiqEIB9Mk7H4e 4oVes/mB5A0Dzz5fk0bWEPCvqWtzHQSwSgECRCfnQg7EYq+QPPX/ADj9+YnlS4kZLB9Z0wE+nf2C NL8PYyQrykjPjUcf8o4FeczW9xBM0E0TxTKaNE6lWBPYqd8VZH5f/LH8wfMEqppOgXs6t/u5omih FfGaXhGP+CxV79+WP/OKlnYTQ6p54mjvp0IePR4CTbg9R68hAMnuqjj7sMKvodEREVEUKigKqqKA AbAADFUu8x+XNG8x6Nc6NrNst1p92vGWJuvirKRurKd1YdDir5K/ML/nGHztoNzLceXY21/SKlox FQXka/yyQ7cyOlY61/lGBXkuoaNrGmuU1GxuLJweJW4ieI132o4HhiqbeXfy788eY7mODR9Fu7n1 DT1vSZIV93mcLGo+bYq9U86/8446r5a/LS0uLS1m1zzbPqERvksIpJxDbGGX4I0UFmUSceT8dzTo BuqwHyx+W35iw+ZdJmm8ravHFHeW7ySPYXKqqrKpLMTHQADFX3rhV55+bv5NaF+YdgjyP9R1y0Ur Y6ko5fCd/SmX9uOu/ip3HcFV8n+bPyR/MvyzcOl5os93bKSEvrFTcwsB+1WMFk/2argVhf1K8+sC 29CT6wekPBufSv2aV6Yq9C8g/kH+YPmy8j9Swl0fSiQZtRvo2iAX/iqNuLynwoKeJGKph+bf5K6/ ovnKSx8q6BqeoaMlta+lc29rPcKzrCqSlnjQrzZ0LsB3PbpirO/+cVfKPmvRPNusT6zot/pkEtgE jlvLaa3Rn9ZDxVpFUE0HTFX01hV8+/nF/wA4yrrV5ceYPJhjt9RnJlu9JkISGaQmrPC52jZj1Vvh PiuKvnPXfIHnbQZ2h1fQ720Zf22hcxn3WRQyMPdWwKlVjpWqag/p2FnPduTTjBG8hr4UQHFXqfkD /nGnz95juYptYt28v6QSGlmulpcsvcR25+MN/wAZOI+fTFX1t5Q8oaF5S0K30TRLcQWcAqzHeSWQ /allb9p27n6BthVOsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdir sVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirs VdirsVdirsVdirsVdirsVdirsVdirzP8+/zK1zyD5VtNR0WG3ku7y7FryuVZ1RTE7llVWSrfB32x VNPyU8y6z5m/LLR9c1mf6zqV4bozzBEjB4Xc0aAKgVRxRAOmKs4xV2KuxV2KuxV2KuxV2KuxV2Kv LP8AnIf8w/MnkjyhZ3ugPFDeXt4LVp5YxKUQxO/JFb4OVUH2gR7Yqm/5F67q+vflZouraxdPeajd G7M9zJTk3G8mRegA2VQBTFWeYq7FWP8A5geY7ry15L1jXrSJJrnTrZ54Ypa8GZegbiVNPkcVeff8 47fmV5q8+QeYLzX5o3NrNbpawQRrHHErq5YL1Y1oPtMcVRP5/wCofmzZ2GjH8v47lw80o1NrOFZ5 gR6foDiVchCS/I0p0rtir0XyxJrcnlzS5NdRY9aa1hOpRpTitwYx6oHGq/ar02xVM8VdirsVdirs VdirsVdirsVdirsVdir5Q/5yosPzBj1qa81Cct5JluoF0eD1IyFnFoBIfTHxj4lk64FRP5DaN+ds lv5ZvrC8ZfIIuWZ7b1oQPRW4cTj0z+83kD4qs/Pj82PzA8s/mpdWOjaxLbafbR2sqWdFMRJiV2DA ipDHrviqI/LrQf8AnIrUvO+haxr1/q1rod7Kt1dSSXI9EwKpkMb2ivxi9XjwAMYpWtMVZB+dv/K/ 73zqujeUHuhoc9uk1o+nUtuJFFkWe6Zk4vz3HxqOJG3XCrzXXb7/AJyK/LG4tNU1nVL/AOrTScI2 uLz9IWrvuzRujvKFLAE9ATvQ7bBX1V+Xvm+Dzh5N0rzFFH6X1+LlNCDUJNGxjlQE9hIjUPhhV8f6 F+dX52X16dL03WLrUL/Ul+rW8IRJJAzMrcogF+F6KRyPRSenUBUTqvmj/nID8uNatLnX9R1KGW4r JDDfXJvbWZVpzWnqSxbVANCGX2xV9UQfmNZS/lb/AI9EJ9Eac1+1rXf1EQ8oQx/4sHCuFXzNouq/ n3+bmpX9zpOsTQQWZVpYYLo2NtF6pb00VI2DOaIdyGPid8Cs/wDyjsf+chNF/MG00TzNPdyaE8Us 93JfSC9iMUYCqIbjlIVfm6UXmNtyuFUx/wCcwf8AlBNG/wC2ov8A1Dy4qy7/AJxu/wDJL+Xf+jz/ AKjp8VeUec9P/wCcnPMPnbVtM0+5vYrCxuCtvPYyjTbQwuOURWTlG0nwMOQ5OQdsCsbtvzB/Ov8A KjzVa2nmy5vLuzk4STWN7P8AXEmtuXFjBMzScGAG3FhQ/aGKvVf+ckYvPWpeU7fUvLFyR5W+pTTa 4qyRoJYZPTaI8W+Jvhr9nCrxH8ntI/OS/tNTb8vbtra3jkiGoBZoYquQ3p/3vXavTAr13/nJPzx5 48pad5OXSdUm0+7uoboakYip9SSFbanIkN0Z26eOFXqPk/zT6H5T6V5n165aT09JivtQuW3ZiIQ7 tQUqx8MVfM93+Y/54fmp5hubfyrJeW1tHVo9P02b6rHDESQvr3HKLkzf5b0J6AdMCojy/wDm7+bn 5Z+a4dL87veXliSrXtjqD/WJfRc/31vcEuWK70o5U7r7hV9E/m35hvNP/KrWdd0O7MNwltFPZXkV KgSSR0ZajurYVfMXl38xPz/86I/l3QNSvb24q1xNPAyQTKlFUBrkmMRICNviWpPfbAqM8pfm1+aP 5eeeI9K843l7cWYmSPVbDUpWuGSKSn72GRy5HFTyXi3FvxxV9D/nn+Y155D8jtqWnorapeTrZWLO Ayxu6O7Ssp+1xWM096V2wq+fPL/lz/nIzz1pQ806frd7JbzO/wBWP6SNsXaNyrelEjokYDqR+zgV 7H/zj/L+b4k1qx8+PObbTjFDaC9UPO0zDkxS4FfVQJSpJbc7HrhV7FirsVdirsVeDf8AOYP/ACgm jf8AbUX/AKh5cVZd/wA43f8Akl/Lv/R5/wBR0+KvB/z3jjl/5yFiikUPG8umK6MKgqVjBBHvgV9h 4VfLmtfnT+a35gedLjy7+W1LWxhMnoyRCL1JIYmCm4lmmqsaEkUC06gbnArHPzXsfz90vys9p53l GpeX5p4nF2DBMIp1rwo6BZUqCV+IcTir2z/nF13b8orIMahLq6VR4D1Sf1nCrxL/AJxOiif80pGd AzRabcPGSKlWLxLUeB4sRgV6b/zmCiHyRorlRzXUwqt3Aa3kJH08RhVkX5F6RZ63/wA4+6XpF8Ga z1CDULW4CmjenLeXCHiexAO2KvEdd/JL84fy61aTVvKslxe2sRJi1DS2Pr+nXZZrcfGf8oAMuBWX flP/AM5O61Prdp5e87xRyC6lW2i1aNBDJHMx4L9YjFEKltiyhePcHsqn/wDzmD/ygmjf9tRf+oeX Cqe/kjrtloH/ADjxput3tfqunW+oXMoX7TCO9uG4rX9pugxV5dpP5hf85Cfmlql5J5TmXS9NtGBZ IfSihi514I88imSRyBvT50GBWFfnPH+bls2kWP5iUma3+sHSr4eixlR/S9VfUhpyCFV+2OQr74q+ iPMMjyf84xLI7FnfyzZszHckm2iJJwqw7/nDf/jkeZ/+Yi1/4hJiqE/5zN/6Y/8A7eP/AGK4Cqe+ c554f+cSrQw1HPS9LSRgaUR5oA33/Z+nCrv+cPrW1XyLrN0qj63LqjRSttyMcVvE0YPegaV6YqlH /OZFrafU/LF0QBd+pdRBu5j4xMQfZWp9+Kp/rMs0v/OJkbTV5jRrRBX+VJI1Tr/kgYqln/OHUMQ8 t+YZgiiVryJGkp8RVYqqCfAFj9+AKwX/AJy8RF/MvTyoAL6PAzEdz9ZuRU/QMVfQ/wCYv5d2nn7y CmhTTG2nUQ3Njc05CO4jQqpZdqqVdlPzwq+YpvLf57/lDNNd2f1m301W5TXVmRdWDgftyRkMq+FZ EU4Fe1/kd/zkA3ni9by/rttHaa8sbS288FRDcKn2gEYsySKPipUgip2pTCr2nFXYq7FXYq8e/wCc o/K2sa7+XcMulwPdSaXepd3EEYLP6HpSRuyqNzxLgmnap7Yq8m/Iv80/Ps0/l38u9KihTS47z1Lm 9SF3uEszMbidC3IooarryK1+LbAqh+eX/rRMH/GfS/1R4q+wcKvijR9X8z/kT+ZV+lxp/wBct2SS 2EcpaJbq1Lh45opQrAH4RvxNN1IrgVGfmp+fXmH8xPL8ml2miDTdEtnjn1GRXa6eobjFzl4RLGpd unGpPftir3D/AJxb/wDJSWn/ADF3X/JzCrxb/nEv/wAmhP8A9su4/wCTsOBXpf8AzmD/AMoJo3/b UX/qHlwqivy01bX9J/5xgtL7y/Zy32sxQXwsoIE9RxI9/OvqBN+Xp158aGtKYqwLRP8AnLrzbp0A tPMGhQajdw1SSZJGspCRt+8ThKoavXiq/LArErWPzD+cn5rxapYaOlhFJNA2oSW6kxQxREcpZpSA GkKjbYcthTFXsH/OYP8Aygmjf9tRf+oeXCqP/Kzy9N5j/wCcYrfQ4HCXGoWmowwM2yiU3lwU5f5P ICvtirxf8sfzf8wflHPquganoRuVlmEk9lNI1rPDMqhSeRSWqsoG3H3BwKlP5v8A5p+YPzGlsNSu 9MGm6NYmaHT0TlIPUl4NMGnKoHaiJsFFB23xV9Pw6Fea/wD848WOj2QBvL3yzaR2yk0DSfU4yi17 cmFMKvl78uvzO89flzcaro2k6fG9/qLRxSWl3BK00U8XJRwjVkblRyOJB7fSFej/APOWcd9Ho3kC O/lM9+lveLdzMArPMEsxIxCgKCzVOwxV635Z8sweaPyC0ry/M3prqOh28KS9eEnpKY3p34uAcKvm 3yZ5989fkp5h1LSb7TQ6TMv1zTrksiuY6hJoJQDswP2gCGHywK7W9c8/fnr51sbWCzWKKAelDDCH a3s4ZGrJNNIe547natAFFcVfRv5w6Ta6N+Q2raRaClrp+n29rBXrwhkiRa+9Fwqwv/nDv/lFdf8A +Y6P/kyMCsE/5y9/8mVpv/bGg/6irnFXsv52edPPHlTyZpN55Ts5JpmdHv71YRPHBBEgJWRd6CUm nLsAdwSMKvMrb/nMbVxZGO98sW092VoZY7l44ie5MTRymh8OeC1S7/nG3yhr2t/mX/jl7EWOj2jX c4dEMdu010kkQgtweqoJT06Upir61wq7FXYq7FXYqo2/1Or/AFb061/eenx6/wCVxxVTm/Rfr/vv Q9fb7fDn7dd8VRWKpbr/APhv6mP8QfU/qfIU+v8Apely7f33w1xVT0n/AAn+jW/RH1D9Gcvi+qej 6HOvf0/griqY231X0v8ARuHpV29OnGvf7O2KqVt+i/U/0X0PUp/urhyp/scVVLr6nwH1r0+Ffh9X jSvtyxVdb/V/SX6vw9Hfj6dOPXelNuuKpLr/APgT1h/iD9F+ttT6/wDV+XTb++36YqmWk/oj6kn6 I+r/AFH/AHX9U4el/sfT+HFVa6+p8B9a9PhX4fV40r7csVXW/wBX9Jfq/D0d+Pp049d6U264qk/m H/A/qR/4j/RnqU/c/pH6vyp/k+t/DFUbD+gPqMHo/VfqND9V4en6NO/p0+GnyxVGx+n6a+nT06Dh xpx402pTtiqmfqf1oV9P61Tb7PqUp9+KtXf1D4frfpd+Hq8fatOWKqsXpemvpcfTp8HGnGntTFUs 8wf4U9BP8RfUPQr+7/SHo8K/5PrbVxVU0H/Dv1L/AHAfU/qPI/7wel6XLv8A3Xw1xVHT+h6Tevx9 L9rnTj9NdsVWWv1Li31T0uNfi9LjSvvxxVZdfoz1B9a9D1Kberw5ca/5XbFUSKUFOnamKsYvv+VZ fXx9e/Qv6QqKev8AVPW5ctvtfFXl+OKskh9H0k9Hj6NB6fCnHj2pTamKr8Vdir//2Q== xmp.iid:0AF5DB15EA236811822A892D41AAE603 xmp.did:0AF5DB15EA236811822A892D41AAE603 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf xmp.iid:09F5DB15EA236811822A892D41AAE603 xmp.did:09F5DB15EA236811822A892D41AAE603 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:09F5DB15EA236811822A892D41AAE603 2017-11-13T10:58:08+01:00 Adobe Illustrator CS6 (Macintosh) / saved xmp.iid:0AF5DB15EA236811822A892D41AAE603 2017-11-13T10:58:17+01:00 Adobe Illustrator CS6 (Macintosh) / Print Adobe PDF library 10.01 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$7 {pb`:nr3{A R @g) 81H07 {pb`:nr3{A R @g) 81H07 {pb`:nr3{A R @g) 81H07 {pb`:nr3{AD1WC@H A E5 uzEHy R _@[R͢DHCE`ADQ r uf)cXP> uf)ϣWB uf)ϣWB uf)ϣWB tlf)ϣWB E@Dw 0YjC<@6zTѕ\{0 S F`(3/g0%xZ}UDx%l3Sgѫ ! KsXqx%lD#YjC<@6z2,5{D! ~=bYjC<@6zQ@5vCZ2p.XQߠ:|E_0`&ņ 0 75nF@@o((i(3P P MHt  b`&k:EĽ xN ~Na5:IfQ@))6hdj}1-4C<@0<^0XӄZQg7x0K1"`(3c@sbB @ 1  AC;=@J8yB @ 1  A |Ug9(@(3c@s >]Ag ! Ð\ix O@#-DldHv8@(3c@s >]KI fR[#1dya:9LU@!ʃGcl^C<@ VxBa$ 1 J шi$>J>;lL88b $mtqj1*!(g> p (rϜSzP l ! lFx#~iq10<^PAA 0 [K Ęc?BlӀA0lr  @3mq0r /zLRl M=G A р탣@Aȴ|#.1Rf>v> KFUh@8b $mt)X3Z7/Р`,G6ՈZXshŐqt F ހ:FPcѭh O@!d> -51Hxе(P`$xm< %~`cAc: >1"bfGG Kl1{@ر ̂BCir.~8b $mt?R1F   kƠc@?@!8AC]xh|>" e"d\ix!_`&V*:TYGp~ǀ:a8Xa? bq} r ȀjGk0̀n:bj#D^hc1.x4|1J715`pM!M\\O~՘ZHM7xNCـN `<^   c$0gq1\a0++ \z ŔE<7x%p8V8\ix2xQx F*b-@u\ AB#Jޠ'aY.++8y [j&'XXK` D FaPu ɤ\ix0lN I!dH0c+U35T°r IY@Sf(69~(3<^ UW׌g*(7r 8b $mt Q /4%sI 20#XH:nb>#"~ѠXȸW`\ix2h bD>Q >]Gl\l=-ǩXM3:FB@3i9€ t$ǯѶH C;Xh  A E d| {0րXM³GQx0+@?iQАp ~Ԁn:d(+,5]xr(|G /b QюH >] 挖Ǯ ꌌ@&,#pPT,~m@ 1#>437n:TeãL!2A@K  2:n> O@)3>ܣc!^4,$~BD#ͣA_D.c"T u@+"$\ix;'X8ŒX@ {I0|3@+2>3rЀKɬn:qF]r|b\ixGgq80`.̀6 [bAUPTC; I @c'Zti2:e*HK3 J  :tƢ {~%|O "HW=Xdj+R2mL NFE lj. cѩ 1\ ƁQ"_@#=qc@ ADƀɐW|Ƕ ͊ k&G0W3S2,)L=( YĨGwO[9jˆ=݊@  KG\b#Zj5"@Xk1%l3F#lQ(?_P! D߀ገ` @ ͬRlTGҀJ ܌h'}J Gi,,71bBAf . FY QD`A|a̓?n J\h<qI!xc(/gͣoQ>8*@i.j"WBXD߀ qD ~=ȠA`pFH5:Mя Xc \Lp`C /x4<ϣ+\.4sBXVe [c!A9BCDa @Qȓ5BXzا>6Q"_@(|3_Y zx(pFH5:Mh Qc M`C /x4<ȯȦ =B#(P  ጐm%Ve k'1E'k+2б(_8D d+, 5 pFH5:Ma XpT{q9P|Q"\B[WX$Ve [c\ Ԁ b Ѐmr$(0D ~`FP5>W1e@F (c!KI·tF5EF`+2EȀ;0@0X;m:7d4u 8 WG}ъ荰sB3,=T"Ob#OVe [cCAPA6ẓ!G nxH0mQ"o|d0 ya T{q#"@uHxAaNĀ4)t) #${л0 5r̤pЖ`A@ Ȯ@!Wď D_ T  *b84(*#H]F= A3.=OPPj52kp0) p#@0?`=\yIII6MJY1A#(GQ aD>ˆ$}H A#(GQ aD>ˆ$}H A#(GQ aD>ˆ$}H A#(GQ aD>ˆ$}H A#(GQ aD>ˆ$}H A#(GQ aD>ˆ$}H A#(GQ aD>ˆ$}H9_5٣(ԫX+Ly05/Y5V[[zdR|TZJ:R*TO_/fHy)(:/8o~ցcA/&Տ'Pr`Y~NIHfP38(ԳǤ _45O!D2`Ã^_7F2(tRALʜH| 24 \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r %,p \ r S# h*JnZYvv&ĢNH[\ \)vaD!գ6ϋuSIOG}qDƈOU"t3A:)[v^9.Y =|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|׮|G^=|שSYH0s㲿~()GqJ+w5sj)GqJ?kQ\R~()GqJ?kQ\R~()GqJ?kQ\Rj4@iD IDqRw>DԕSĝ,'Bތ #~-M={ϔϯQ `==MoP:™b4 HK={ϔϯQvʟ-)u<6TΩBfjPSi<6B8mpIᶒm$#HG i!6B8mpIᶒm$#HG i!6B8mpIᶒm$#HG i!6B8mpIᶒm$#HG i!I,g S3Bqj6|Ȟ}zI}@޷6C}0mS ֯ǼO=Ec`{)'^>hv^p@{ϔϯQ{?x4;y/D|_Ÿ F^=|רϼ>/#y/w>BKqK7^ Knu. pmFA}{2.V.^ egϼ>/#y/w t` 2Z(2bMQVcYo%f9VcYo%f9VcYo%f9VcYo%f9VcYo%f9VcYo%f9VcYo%f9VcYo%f9VcYo%f9VcYo%f9VcYo%f9Vaz{p DwR7 W;y/D|_Ÿ F^,?[G0Dxsfo%菋K4JRڨK Z>/#y/x*ԚU~-.Nm4lte`e*NzCG[o%%d[s4GiXұɥb?J8ѵݧM+V#4GiXұɥb?J&M+V#4GiXұɥb?J&M+V#4GiXұɥb?J&M+V#4GiXұ1 ð{&]}ތ>i]%@ZD|}Iӵ0@ro{E>E|'9p`NK;BK_7͚YTr MGk{-vwiz#mYAt}wYSc5eMjʛՕ69*lsVT欩YSc5eMjʛՕ69*lsVT欩YSc5eMjʛՕ69*lsVT欩YSc5eMjʛՕ69*lsVT欩0Pח>:K-0HmT2/~9 ogvw9XBIC(M{; l“-khRzV,Q\*)Z&]}ވ~2g;L[&\咎!%CJ8,qY(Q9drG咎!%CJ8,qY(Q9drG咎!%CJ8,qY(P) rR:vTIN!%CJ8,,Q;I¥gٶyk{&]}޸ȎJ%ȹ(M{;mQmqKrP-㐛{-vwiz2#0:/-Jrb:+i+%d %_rt5;=e#=?| r%Eh2H1If02=Pn?a'>O} ?Q~$GIR)CScScScScScScSb@̫jw/KQ /X<<BvJ9ζQ'ޑddddd)\l_ߺGߺGߺGߺCNԬsmevwZr;]b$HC/R|_ŹJo>}ddǟ~+_^pSt0rJ稾/ܥ7ŏP>2cϿuk/Ƨ*m3w)r?B|ɏ>V-ѻn{@u?[FLyme/ oEY(Y(Y(Y(Y(Y(Y(Y(Y(QeZCk=*tjR /upP>/ܥ7ŏP>2cϿuk,H]sh?I:l'љT'>/ܥ7ŏP>2cϿuk,QG|)v>$lOEX+>/ܥ7ŏP>2cϿuk,U)J4g)UEJMƃLˏ 1mZ۷~1mAk8MpP Ū>/ܥ7ŏP>2cϿuk,THAh;Bj9eNkXVOp[=stY}kE~Ssݩݐ1N$S8N)cP -kH9㪪%w kƥUG:?C;J ua 5ɋMYՐ&Z>/ܥ7ŎrKs"a6Tatԋz*\;JI,5+B ̕Gk%{N B|ɏ>G%sR܊͘au"k]/Z_]qbm8imI "wj ҘXʊ{ұO*V%S5I\VJ71FGW%Jp%16ìWxH3C%#dwSHZC7)Mc:9ꅭ]GOT)u&sd1F*P>}ddǟ}RqLp|D-'XoՋk,Ywoa6z*5}"©LMuCP\`Å=]Ra=FAƾ|ܳzZު4;m]KJoSR##r&-X:`}滮R911171Ew6t/F 5ŵTSݿ=::RX)"S֪Y#jjq Fװ-NP$/6A6瑥\/=5i ʟLhQX@H1xMs{h&S|XbS<^A 38$ئF3&T3pJ}#7Mr6$srcS}i!ۥbaD0DŽnDtG4a[y%v6*1ļ]t(]` @*%lك0͂芳#"Lx2NzNC%R'M'0vXVV,݊J䊺dǟxm?!tnS"` gfbӓiB ۪ZGJŵvvwjw%_aO(ew5 5C0]0_˞{.z}cϼT^JrMsSԛ[BLeG>ܫYQOvu>Or*TSP "ܬwbKKKW_T*ɣsH\,A2[.;;ʄӼ h uPl20zYM<4t=PVLykpߠ M#tt(RT=V-4BG1#̶f/mLgwyq?9{&U>@j 00, @IsD @hy\l k+?Pп3"OR1Mc;+eeۓZɏ>wP)f@c˸QKoҬ#9+YQOv琓 ZT:d4{;(glk d\jFo4ZME=NTeѬ[cq S <`-ցEOFbb^N]ʥǯ1Mc* Qu-jt#J!嗎] .HVLyK&\(-%,wi)dۥb*)WU3-yݡ%ǴP?S'+P.0m,}bSG? KlL:N&MKF< 谳}=2Էs1s6(jݕ+4t7ͳ"SkU]}ⲄPBkRFc!HF+Yad0GV#X!>+YQOvPU@.{[ pQqVq[ W:'M,r*)8t e< JSuE+Sԫu,)M͞ .Krx[G$=KH+&NN,ˮEiM1w:|Mr>gpR;*<HOiV^]$gz]K==LyUQH]NRTMHM1I2/Ish (6U#|_ȝuh"PL'jŵTSݿ ]3&Ȫ*A:1])raxiyq7)+?*[IREI=Y؃+n(q(۵b*)ӬѨQWLw3z>Kֺmd(U8",{2zfVTJRc>YS1 :u{;;;(]IyJo\N:2[Mr/U!RVU|VFLyp{zcxx[YeE=x$kSH9svwjvd\FJkcI԰Vq w 0Z&vwjw6+6sE7ŌrT1t;ipU78v1kض[qnZx:eJR##hʌK1b-meoꟲ&cQd6)5#wT^GB_ࢍJo͉4,'*Qj]G|gKF ðnRu"zޠeB.=vE PX;[+` dMRjZ a5<\P8DqqB "ӵ65@`DYm (:L0kK-gjVɸsm[Ru:=|ԊODqqB sE7iP s)I},2E-kkym϶oJ W"43!R.rȠ2Qm) \k jroIJM+8c'uv;1z1!}9S,Td8NV#=!_¢A,8,-g \=DƳ ثjГgJqY*H88EylۃOJ!okY%`ͽ1yev +k#E/|]n ?+Ӝ F]g`l6f3&U8i*d.ٷ앜OG;!UԸo"zA76D,@B|P6#ų2 8BIϨ_J/ Ʋ( (ZKڨҝfU ms$y(-'#K(v fo' ]MsgA%|K7٩ّ%`ͽ:FIQ ZZz#,vu}lʐ:(:h=K;rWb DjB["̦|{9#Cf |-%J 5nƾl65} a[6D-S٧ئ^QH"Oh\Lk7oN%ਇ3b= mKe|f"DdOFW XtnK:;}|q^ +u*GJ.f5qn+TDLLCvaUI!1 *6Iaa/r$)JSbxPYQy1Iٷ2q:T4ikAh9r$߃hA3ҤwhX4t1v'c 1t.+Y~ ~W ɻa!Eer01(ՊW"3D(Xqb% xC@EBXO(AH*iZ&IXDt>$e-a70TTg8dєAM! QN.XK-dHǢb[Ⱦ*lZAN7ܢmmXA+n0Q_ᤵJ f[k,yT-0$v ԲM@jqaPip6-6V6 yy+O' sw:o\bG/̜}y Ņm%b-piYӸn^Ί[G൛\w[6VD.j_"\_aϪd\e],\ FX # j^Be\ vok6J{HbmmP j`ϊ !9ҍ'A\o-sZ,l)b^`O04p 9R6&c!U8| ȆVw͸4d]n ?+cm҄Ua|B0"E~SѸ[茕8΄)jU'gpE-Z;-piX޶E$ڇe5_ՀZMVS\Y^Hpr`pZlS A/mW,K-bR6"M=Xj;d/VlrWq*Edr/{-7.VnGXW1L{;5;h(y\{ yI+uȢ#ylۃOJ[6u?e"4Z%!w͸"-fw͸4d!HK@t>V9 {X@v ?x-6ŗa f[k,yT+0G2;&> 3-|nKgۧx4L շM,T+LcBN Ӱݢ+B ;fdq1-TW\(w;fV.DO4y ~~ Y|5}|]n ?+ {}6v"ǥEиa:[o%5l!)wږ@?* @`l- xgsWU/)!CIQ^ *&%%dՉ!RB*`2.Itx ,gT5lvJ,߹΍-yfWnx/?;fV'hC4.Uڤذ_׵xjA[C81[nKhvkfT.&ojꔵ:R.L>?}=T'FlM+%[o%IJowт+ LSHEISe?J߃P7 \zF,^/*-Z(͙5|meo6JɥR@0&ub=t)m丯 i{MK zGʞV6P0cʐ9 s΁_%ત ʇo dWIYS:՚^6t\PsPXMe.,ٷ앑u^9m;&E-Z;-piP򂼠#T3hSNF۵lČ0t"]st- 0qpSZS"ӏ{Vӭ2R^pFbT7-q@[X@Rr=1//9.m =t#ܤԄz `mPgAn\P8-&X""MZ&MB8-!K| *.$f%A{'# LXP&4Szp[HD5ꠈCeP./j6l JK7%vG3"B1‶`5Yj(7&=E—mc\$&=Jweyfƴ&WR-&ĜPI#ΑaqFS̤'(K rʹ.}Z}:IzPy`P"dYw,>O????I?_>rݓMv㵓lգVəg\XE"A9q""8]9Ի#7:ϛfg:r^~(ߊ6Qyon-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ uۋGy|/on-]]v_ u8-fFjIbtcud_*DS26 .rD(J#TKND۬g+=Rt+UL7"@Lmv 1_Gi ?~vQ$eYc4(;Mk\9V1e؝>N# tWfYHR**f"n9,SȈM3-TtI|c[O42hR4IR囉UdcQ_DS/ yjQݚK,dۦC{N&.W6uHz91\SfM<C*F=v(qQى134 fI3Oѭb[؜|P1S37jsfVr$@wlM:Xs=ye hR23ԓ̒V֊׉f7<*4#Yf U0&S& a}.C=W+Wĸ"7O*ʴ(hYb%Q\Jv F5˽Y71F02@DE'*Q_)FfiF UF f%Dd\FHPHf$ڬ{ Q9(?9,d.ι$1mAuH.ˆlb*鶴Idw)1(TyTujBf}yEքMTCqKLc<ă t/: w#8:q+^eE:Xɳήs(C'[.j9)q ]ycMX.]bZnvZ.vGc#QD3D@u 5O%^tzWv>UbT-֘ c4Ր~xݻpΌmR_Uk^hxw0YDmE x*ie?(wTed2سLcuIƸ)Y d9a.bN)HC+; Y$\-6^х]9ii9ѧfb5nT|"@(,) p)jKJyf[UG'cf .**VV *ENe>=t*+WpN%dQ;+yWy! VjPM50˴";y#8d,xḱ9eʈ8[z$zϞR07m z&PKԃES5T@<[0smy^gW+u!"DQ(;aeY' G7Dlj ˷v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(e{Wj1]v(erԽzK;]n,y!A EqE@0^սP2b^U/[xt̻j$;qEW/Ķ { Dip-,lZ"R`w77*bV=s+$2rYEPSu-&u3ۓ,XLbDx(@PN_cn7:B|;1ю̔:I6MNRR(%3@@E+E!p]=YI^@t],bWͨ t%K4.ޏWd᳻2MʤvՋs8i_R+u uN>Wbk1-Rc hh$E2$ewvMiʓ]׆7Vi Qb]J`~;\[TА# Y8vY4\EF.XlNhTl飦 XY,A!p \ weiZeG'isba||EMe ucQv9B.*̦0gpnb!{+reHHBe u1bׯ\"ћ6ӷNT*-6nNXB&1Dvf+qXx!ӰI82G XLpIHLegqj:ǴDX rsE4$QVhS1lPuo[:L(.eʋ*"j8o 5PU Y.jje߼>?!zCj [Fp%uʧnGdIUFb&MȈapDKIi GPɢw J#s~2QVf?$ўxC$Ɩ9AR5Y2(~?!zCiJCT:;CT:\?!zCoH?!zCiJCT:;CT:\?!zCoH?!zCiJCT:;CT:\?!zCoH?!zCiJCT:;CT:\?!zCoH?!zCiJCT:;CT:\?!zCoH?!zCiJCT:;CT:\?!zCoH?!zCiJCT:;CT:\?!zCoH?!zCiJS7/q=16}>elAG)W)Uh_Yng($c1" !YG6U@2̚g,ߦ҄gGHAKmUȨn޺:I :uZdoD:*'#~Y1STsR@\};\,w3N9P8r҇Yw q9q""";~;~;~;~;~;~; 9`]fErntQI3%(zQ3!r(bSCxy@v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/v_6/vjSTx9`FISni*Jץ٤ :j%qw5s[+FRkHyE ֋2VPe4ϒ̎ANJrvuLF@BE5L/V(Y4p %^w=+9\9vGJ7mSYB8R"ZMNfb&eY3tlOliB*?%~UĄrcoyY{ ߭X'Q%^is PRHe DnprCC=5ngY9fo YϴƢdJA6Y [$"[@VMEWm *]wOzWVr>L.$*X:r >&)8b?&JFxzu)(hYV;V˪iwAz볂lթj [R2#Dif'; @AE@eaeZFr \F YQT!(egʎ2pKhSzfT^iGo]K.+UL;7UP;ޒa "`1+I&k *2u"eMcLLPGnt?!zCiJJ=z]4v/gnt?!zCiJJ=z]4v/gnt?!zCiJJ=z]4v/gnt?!zCkcʫZp%GpFU&UI,*SاM`xJ=z]4v/gn|;v;y8FcgeZCY͕a^(dh~aǍ2QmY$᳖ "r,K$@1D SժWβ1uxnYR eJځSlh< 0LnT) E Go]Kߠ==Le q$Wv 4 Dd;p`RVs!4|4ȼ9TYle nC3V-4*3;7>Wok,uqGXzdN@OD8w/"bꨒ SQ~FR3(y|;?owt{w=txZθ;r;R ͢ |E |CJUfTo$MS0yCl2L+BWN;"^L{^P"G'P ӆaRC) J_OIvA]U߰JHQgBUL8$3 wnan&Bu4{i="c1{gH}Lu&:oa~o􉎿7{?D_="c1{gH}Lu&:oa~o􉎿7{?D_="c1{gH}Lu&:oa~o􉎿7{?D_="c1{gH}Lu&:oa~o􉎿7{?D_="c1{gH}Lu&:oa~o􉎿7{?D_="c1{gH}Lu&:oa~o͸]0^3ibwi9 9VhʴqB7E~4?Cߠ==W_ה.-ԯ)9, fӏA"yJ |L +AF{{ۼ?9콥 mjnܐH% dU :ʼU&M9hNCGtlbMTBojTk?It VUA8)adx̫8d =3(y|;?owt{w=?&,x֝zsJ<+e$*PeS-Zv&w SMK55屮R,EHrM;2hTZXEFu$Lvr QLD$dڕߠ==a-u*TM,_,,Wj^hL6PSe5@QsžJ9G/jօAt3yPsF2q߂g9}3(y|;?owt{w=';5 5&fYih3xǿhYHtLSD6iZ!Rrbv %$L y RJWYF3un Z+%*\XHPd2?3:!Í'r(.g9g<(銄M2(PHAUeAB/hnwN7Hc&p!*W;~óQGpOxs !aXVyQ#p}3(ҏf9@]`E3(a)x@L;;{4i:F c{4i:F c{4i:^~fFf?醉 (ZG&R 7i7HUHt0Q1S08 LCD S@(F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F c{4i:F cir'Px-ȾUd08,x-"|Ӕ!Kptҿg;|=Cl}Q LBu pLM0rn9c1C C1D@1DJbn(Q~FR±N^XILa3sP ߭ꋍ'Lp;AO8é 4Lcp\`v++ג`Vp,(,mt{w={\?N()rJ =8`;6d7m ~r2!b)bb >PyM!&<;#ǵ%ܕ-y kC8;)#t`TR&2EvYYF:5 7Ux{møL85xڏ7(o-%h&+bǗr[K)VHrjuٸnZr&D(tKEhg \!ZnnY2dUURs$c L;_&Ovy\KK{$2-REtRtB pda8BmKHs=O0ECN1O$8m}Q LBu pLM0rn9c1C C1D@1DJbn(Ra<qw#CHIsi5p3J!E0;@qud"gV6N.Mc^h6&sXz,{het3M(l_ 橁1`i7$`)@Vz/P jCxx#?pzYo=j+EfpzYo=j+EfpzYo=j+EfpzYo=j+EfpzYo=j+EfpzYo=j+EfpzYo=j+EfpzYo=j+EfE,fj,&*5:1YATLLS{P3x?e(Q"훂`RXI\"yw",|L'at\KWxblg2Kݍ/3rqJ'+Tx@!{\?N()rJ =8`;6d7m ~r2!b)bb >Pyg5*KG>~#,^ vY(o۳H!7Rb&聜mފ61.#HV'+$$7K Qv4F"n3z:8ƟM6B֣"YoTƺtd8TLuU19? _!IYnR)ټ&\PnM@vОw#,b!a!p(( LQ 3$bl]yUҬ\ѳx dvk|If=b6U%MBsΘblچH'>K%e 85Oa;c)&pgs3VXjG5lcOElĚ^DQ̠*"xqZӅqdpY̓g[=-"MQJtb)HuNÍRerFۨ8Te((o,hFI'' ۓu8ݴ')rHr!") SCp@}嚼i1͸w##ڼU1*{nƲReG.vll9z'0>_MSL4gk X؉fN/5>8" u R8hֻ)1Jnrh`dq;t+qRE) a([ϙb(MAE&Y["bH~9rdZ"GVʌJ%O'&.yJ.,K+AWU߸D[" ww;?G7TEtƠs.8:EPr6sym Ey˨UdQզ;:623E7SI˽s-U@7"(Ƞ_x[LΔm^g'ھ"9Ҳl UNޭ !IY%ڮAGS4Ѧb5: Ms! Pwm[])쁐'nKģR DAj&۷n?BTZkյeIO,% 93iɸl庉ɔ1LP[3uۇWylon_?]u]v[3uۇWylon_?]|FZJbzf-w9r:9JN@y8ݓ b*3{)&Irb}T)M[4K"["E\b⟓+#krd4[r.}4A)|2]ѝhr8o"/ã'+~'P?vP@ ABuo b'P?v{ )JLe$\!L'P&0?jރK׆tөU ~:ZUT@1""$@c@ ;N? :A1;j6NNi{}vw}>"\!K2ЌY(W( aMo¯gp d.$E^._pnT;,Bp:WKƸ7]h:⮣|J25D5Y'<ڴkQɅhD܉e*;ՙ(ll̿ ~iViO`2v9xQ7eT"xR-Ȩ,8! `óQGp[M׫mpԷ{WUſ %5oՌ,l9Zq?oSHLΣ$ٮ~H)FH7u EBkZi`p~+h uMc&CVSZ ӉQR3óQGp[M׫mpԷ{WUſ %5oe_q-wzAs !i| Y5/1;؇9r5;tV:--UV_ wU2twI,}a]I~-P]3ϰ9'"PNxV,k wg;WUo\^ы~|K;k#uo^;WذܪvrNOaLnΛVw:$#FqJe]N&iW=DsW@Jqd:7,RVh੺lD<ѵynxZU.y1H]&cIu(,9}8G.wg;WUo\^ы~|K;k#uo^;WYJk]ixzrE,|s"+SeĎ``/uthI,^[j T/vQ[N(ȪdbϘnfɹjʳw-"cu8 LQtp~Նpö]5#rviTl@:,L%!D?*,;",k]ԩinZf옓QLe(C.$"M! ,2f&<ӻW۟־p 4 o_9N6OU *rMB7H\Yx2um(Nn8 U(2DxsP (R^!%s1{ks6{[=׫}tb߅_]r7[×qU|Nn)v}sXDK.po(L"TI,}> CXWȸe[6|hsv e8H?Dwohc&:s_| 2 9MIʍQ䜪.b{_!gys.v\a];in$^l]]uGEr3|PT* őц1Λ6s6H])YC2-?՟n#vʉD7 2HmLD5Ʈa68XH'aL1J 0 s99Lc"c"&1wG~Dė6[l+;Mü;,VN*UP f*- a2Vl9#&eQ̴褥_#m1MP,~q5*(OٽXbLJRp/%~ٓT@գw'nv^ tgQM.vm4ۂj4Bqp Ҋxm' A(Ere0&-U%"pW#ظHe8Q҉)\Za`UAp@) B;.uCa#3(v^XN_T(KL 6+v_\9#9/sR>Ap&J&]6dW: *g,a-GKQ5 In%;h]mf ɖ_#i~LLe'THnS]0jfh,Ԯ\J1ceA3“]N7p%)Kɀt뇽sz~F-9pՅ FQFq'3J"Hi 3Mi)LqN @tZIԟ] "i)$" ϑXێ%(po6>#,c.Fa+#(8WyŔ<| e;*hAA2~ej 긒0PkFǕ֥n" NQMŜSSUEzWMe)֢CWsn#o3ȽKFʉ,׉@V7 ,sr(l+)#]НȈax(HCaՎ tӾLMڡ8%F!wn(nü"ᨺE,eKP]R1q՞YI,ÿɲKkdY9TId(5RPb(0 L ;ij?\E{D"(g[\W"d1)LU-g2>*j(JzH&t92$WIb5V(r0 mcb(:k6cԉъc.*tW`%͘ , ݢ))(媂!,5\* *s92]r47Y|"$ EQY#5RU3U% tLSکy[VC4.{zLE\*/4EFώ=ӄo4Æ5[.QBZ`wR:dDLE@"\+5S9 RYULXnM%jRMf]cDY@")'qum֖qP:r3-P(0W[Rq+Wd̲bU&L&&W\e^خ4:@ e6 @ (=v3ջ4xlzb{9nxΔhA@)Fݕ`g'RRgiVYdt&x$bn"1S4YA"mWp;h]W=ˇ' UDvփ>Ѧ>i-MAVQsP"  UQxͲUFeE0qdu-Vl}I՝ӤDTI1pc-dcQVe! b9fIG$UU3霠bN[[:~M(;S X]P$qQR|ދm"HG%avSE-$ & ,t2-ҧxڮFΈ."0vz5R޹]Ww?sɵ)htf*2m2(+EHBNN41PpY.6O Zؕ+KՕI$Roe*7`׈IP}q".0ZUF%«*'bB5M1і%mxd9e(#Hϐo^v(8-p}YYˮFxrN">=$~C,an"EhNK ?L9xpnf˫->I&fqcr]ƾIP @0@:3fFJJE,"w/>x7hͣtb2LaVy^:jK

.&.=pIcP[MZnN`s`ԥ +[r;wem|D.DO=`U$&C3w*WXGr'.?OF7O`Q3 /Y89շ;WeY+oQ#%5n/| +ݫ8‰򞣍 y)0XsSՙ8@A>:f*$} 0b!^&9OQ1>飍+56V >Cz| c5ۼMղVinjvk+!WU\8ptNqoڙ2-N*11yrcQǔU&n2/hhIـܚF$"[T0L2am8x_@Ug VTMnQM C[w`jTx%ܢSwn<J\nU_el)$`3BUۂ 8ʤ @')Ug=0sԲяB)qqOfsX2G)L ![MʤyVr*ojHa6C]TeXt'R sDc;Q{f+~YgdG:i;\E$s3"(\AB(?캮~F-X|.pY6$Wwj߲rC1zA*~4ձH(b̿; DځFGeXŖY\As|,3 D["[3v A nGDca˱i'-8vB=Ej֪DLMD(gp d.}8WsW9(p2+` k,e::9vPfH)|>+ &$6bų^E6mQ˧nT[le.!LcjytJ]RI7 x6ɖ̱& 4;HAT7`Ԟ}A^B?U16;{S&vKR^W7rܞ);7jeLa v`kE( ;$Dwesα츦T3$W%Mֈw&p$&M>ZbR?_M?U?j%7'fExg/iU&((mu1 0dT|sԐx7 5RTQ3J`qws>1oVqKkLiȀ u^?7ER T,pJV2@y1nD4}k34l ҔJP PQ"@Qxt)2S`yywVJ駀x5z(*K M>nH]A;,#u9{`^NbATkB$bű!;tH"S*rz-dآuUЮmrLD5ljg*|T(81lG Tc(cCk~':åL*IW ܕ-wuEUٸL{"Y37Q߸_4 GřT&V`H-m,z[t;m=dY#CX]0< +SIDf!cd*;)2jDAIr]Ϯ[~!eM~.i o嬢=& &w UfDT04X@(9c1cc">Q"Ҟ+X!II0Tԑ_l S(ڳJs"HYTE(GiMyR7{ö vպVLvv gsSK7)QDT:1A~(u.OosŹ*bIv;uJT8< ­&DG=! (H8ȢFQ3ߴyQl GҍZ6-YnӪ(u5K" 4bi[mR]9a;d^zN!̲]ʐwx3/ ]r7s >R_2QFJt"d$^AgOٳAET)v3S]C)6-YIqqcv( _NqR\Y65S[M׫N5~r5M 9(tASH/RQ"rJS:^H$N/UAjy;;H dTk^tb(3SLB|[UqRQ밵*Z1Еv9LC" b$)L=$`W f:u&.A2}G&GU̬Y ApղUl2Zĝ~,f2Wd]k"G(5%j]D?7x]N#"ʓLuEk*f0Ec 6'V &ZՏl]=J!E!5ʹG˔8- 'm&Ƥ4bvI3iE ܿTFX V EU^r cVHSU"iDܟ,A(τ8BIyzh0bnE:,#gLs&sEʊæ)I[.Sˁ"T@pC礗OviNjv"{d=)8qj'|PpxNd `T1±L%nv?Hn.#~IҰw1VDp301+q]phh-c"bXbmG0nVLYHIV*i! =Q,'!ts$Co+dRɊ\0IL<70&zh]W:s]y8Kng tRqFA,3{E`9MTNt&Ԏ'wZHmN"NkLeY4H8 ;BΪ S*U#SaOa$1#&9,^f(!;3o19^x ws>1oS!RAnXi a<:ȭc|D@EK;k#uJB9!c1#<;@dL-4;3In>x9[4S'FIP4l_%Pp":UƭkIE2W*M1Dɥ7njܡ:{r5+&nI_(|j# @uFpxEL{InƥMWb[Z[1 %FEB\EÇl6!ܨRDF+AfY[tm}gE"^ƘU 1DOsdJ"f=TsVd[(')U>Cj2s~WnV*_'骙RM'PCR:h]W:tCd [p71 Nʐ±]p"Tw*~R+sڣ * |3$'H;&H9`Qsvh8R2 W-M+a(Jf(o8bC}tbާ8V;VU\RiȓuZ눦6n,EHdDBSTxd%oʵR!ƅ>V&p 3RK Ǘbº}exBrYTȾndNsZ P@7Y1L =}C* "u U#GM˅ sU+&.򂉘@?4 2i3;f r[ubLS0;]G"Ʈ%0(x7"C!1x6CZS6嘷Y'.I(H324AZv͛Dn ( E*he)JjԤ#uE>]ʡ"jrTQ=_k1ˎto&#l . )!" =We bvz+#49 E0zh]W:td*92A QId49F&Ry6m\L[48EG)VfIcD&"C !n)+d5;P1dW5 JlD9СLO܊)r"SnG4A9w#|+7e>wq7N.wG둺0wӈf,"l/"ݳvS&JPCg5ae hh;VCYU APs[ZTJFb\,%:њ8m(>j&8r]2Yp+7j|`dR1V"dG1rvErW)f[8DEvp9A >M@fiX+Nݪ W(['/ 3?rIQeP"D2&I(k/5BvǮܬu-:X1G&;GLjWG:uLjQ%"[=qf$8j}/HpS֦| x/,PYn '! )XOc\=MjT֥(|}YlV*5(JC@*@/7 -TzF7`ݹ9f_:1hH%E%M20"q􋲠R~˸KdJm_p$υ%z1xbyWS&t r1w~-{57l ˚˙>ܙx%/kT8R^r (Gw5Ӏ.I}5Խۆ[wyMf"=.R a7;O]͒CJ4:gJ3#ܛB! RH<@`sі>#3}52@,>K!g!'T28rU&Cyz~F-xWnfǑvX3 # e&oq*`X|##Y]3L!,;b}91PjdIr^RPx@Q2}Ctja$:nnԑJ fO:i)T~qr虺O8Z*d: ӱj&") ㄢL!@<^%5n/| +zq~K2>DRptDU8HpiȪd9U狖̄֜rQ˸v4Љo(MߠJv-Lɤ .џZწے>pֱe~xEi(Po8\6xԚts#8j9܂UOa;23͒9Ȝ`("! m7ؿZQ ~+yb"כN%8n8` ٽUmU\xC"d21\:m(ܡb'@"r6WSٟ9jgбN#6. $~˒1M]ɼCs!&p^'LuERL4[9'2Li|E+U1uuUq]:k=!dBdɸ 2ђ/Q,q6MPblY{5j~=&fj)%pN&Z5w,$ r%PA(`{'gdH,NёC3PY_rʴX*pBz`Q95pN\dqr,:ڧac)+YthAx?ۺ8ncɍرVղ%"y:K#+ % v% @|y*\-1XbvW3ku4:*噀 n;WUΝ]Φ81D$hYN]E <9KmPx{ 6lr6i$+a]@3͑I 1*CeQ:S5Coi%;IUfR~Z-7)H>%ыzGFS-4r8[l(|6Zwn(XYX2]j?4 Ҏȁ\%uTldiڬSgk\(ij?\E{C+|^f̹(&H9 FI剸T8(b(fU3pặ=3g9V,\eg 5` >bE7p8 S!`9A(0 LQ !Aگ@|7MƢJxI7\qP\CՆ-!zyBi^&*9n[d^#T HbCA7#HhXQ1SلsPf͹7&B7r͹DL)"٭1]MPSr0XQrӳ"X]7Y?Tz#I;I=(#TʷIG]u(ddQE9Is:UNѾ &ᅟ .VE0G  >90NXNGiQ5/aOLڣhlN(c$RAW2gi,g?:]M)9͘Fsϸ@HmkM1}-R["Taǀ8TG;ᇗ0 eZe_+5xq9'sģd9]h)E $k WvtZjpnݺ2.ʘ)Lc@(T{[Rsxc*⪏۟"fɘ^F@ dqB,eKGw5Ӟtb:iAg<71+V3Qp8T*ӗHb|rb0ZU55`Y!ݗT~ELkpA?bWj*S\pٕ"phmi.!Y.H[:MK'Tvc%P0bmNvb[BW&ߗJr&u,kstl(iP(Z-b/<~ 1dzyhܧ4allDϺyq8Q9rTc9,xEҍ);&&C>BQW{O ܊GqQ7FQ1o9BQUꂒ u\.*t1rCD! %1LSCxy@vKKYzl+n!q*'E~cez6- d+œ"٫ "?|ٕ$^ùPNScuIH]NWN֪ %U 8${liiQ""!pY [dOZ4LRGQs1KsR8ѯ1imѵGݢY&g lt!m d,ehɲLY|L{n! Hjb֣GQ8lm sC1uW-WۧW/Hɠ ;k7fC-PiW/\;|\uv *%,93ɩ.ZFYUJ d:ڮ~F-jMq7LFi˸l*%1|韯' RVRKĢ +YHdIT$Q%S8Q3 E_6%#=Ux+"ufbTkI*fN( (8&,>aܜًu3M&ż[Dɂ%-.J'2]@{N=تsL(`As$ыDٙ闪$69k=~UuSLL`BJ*v 'Bmd]ɤEz9ιLopt&2j[bcq.F"ue+ 3Od){Bp)$,Eij?\E{dG_ɟObv⼫w\/Lշ*7F@KU.Tj>@(",Չnf"bnInb%cpJ5EH+U3a=ST:n3QnoyhʶQzmq[6r- )bFÂy^-7 W2*lu'pTF~,e]0KHJ$pJdc'̃ywedݸ%'$ŽHH>tzS((5֬˛%[Q9C&b| X.o|cnUH텃'iԭ1,g6YJ M:bdLUSrF=҈q8mCiBdHc)i8(q 4|\8njCrtZBJFV;5d[q2>jX*KHS^&.ZYAlE\qn+o".փkMh%(∦[7cEd:3J8/5$$E DUݥb*- VJw@l[:ØqDcSAFvH.ِ*›rUC1ij?\E{+G89V؜kh%0O49 ޳dZ2d ]ڍ 4dK&4;۫VDmYqfCd՟Y79^4'znjOհcᣴWdI RUg9#b56?MX ^:~eҾ/3 Q:[]`xiro3V~*=rBRD1^OvpA{>V|:H8\ 7p8`t("f?=3y|1pv;e7{G \ge񟇙CI6l'#m.p8)ofމ ?:m]#c3ջ, suYW0ˆ&dĥYAM0Z15.U5=NqJ)n =:Z=AQ)3p3)'$d8| zN.ur(s9DDG@\yp||[]4Nג.+7 sads`e̢W36a:e޺²gqaliC0sfX.HqWHC︱핎ĠrvɛW*9Hrc"` I"ܪ.%8YƲo‰@˰$khnsEQ̕"EE@LA#8E|[$AC:#9k[2f̉bp]ב3j%j U`ߴ.:Q;)|7v `Q'<)!:ɔ %8Y+l͐eJD.BaYܠPhi,jNOBZh]W:[cY+P*} `8n(iCG;Po&3h!)(\AXG)9"P0(9jl]'L&I㗱/5T4b%/P#b{/^!pыzE>%j>zmPSn1͌zdrj"FQŚJ1Bf=DCqRm0`FM'L2tU% UPSu>b'"Ƌ(GM*ܶpXr)6Όuan>(wE6L& hbZlЅIaűS(( E6R)D2xqI^"OƔ3Pø: }<+\kvni;9#9uS\N%-唬 3%:A1hb`!əB/ e+id!^,#b^,S\ yWwz%,`ר*]Up!6*$2Գ$ҎT S|bUQFwYYˮFxrN"aJVW`s`~#(%IWʫn٤HznP$ %PMal>=r")<,#u9{`^+^FNƾbRfQdc_$)KXIdbQmEBKCYt`QLT|O Y7 &98i%CѮwMu!(s<ŃC9Ȃ :y.o-]tMqF̴}qMl $Py *a؂ 9`9~F-O-q6jRfǵ35%FQ-!Y CJ"ZuC괵A cImY /LH7j*ꫧcO~X[9tDQMcF(AQ8[re*&$3&E*LtLŸ'E42w37&C;[%H;nJ)ED*iij?\E{@91>Q^)xgSe[d$ܳxT^1xN&\Q^j N9R-m *Vmru"($ݠw褒.zտc\:^ V7icLS:MN;Uar"f3@]]TL9R!9 b(A}`*9F>9%ODͬyNnCd&`ITlxT8Ɋ2]mA9H,#̉4k-1N0Q5_tc_Jdlm$MZEK[-I5QRGW`?x)$sD!pW7xK\Lk 99]E9opMFZW׸#5++eHrfYݒ%E9%#5pU(P0ZƚPjOFu*aq$2ޫud@8Tcb2M4iߊ2R9`!@0(aڋ@Z:uMzeŸk%Tj7y2WIFVfJ$G5HȂ ŏe\̀^vr5\"@)&rU@@? Gw5בx<87IǨjN&bQJF6Fi/URjDĶLW{湌DfE UW*(.XA`IJOs:a`P/7iAV?zz!9JРqAeZJMbvv-ܹ1R>vŝ=3yØ%"XGܳ ŧ4`beAs%>jrƵ[ حmX!FE t7<mjHDێT7ǩ}tb޼:^mPU=Zzch|wq(Q9r 6Qx\W$.^` /]Tmu<GH9iJIpJ2Ib42|FMT)TMBL !\ݨfm4eJ)_5DB,,0fe(8>u hʡTbPHi s= "Ƹ\)7J/)bN;8$e v7GD2sg)oxed@cw&~-n"]Ṏdk3 gJ*0E&aUWՠr,LTMpv,")Bf~)GX*v9:՚ @"c32ՔcBR]"; L*g+YDcq2n̔Bk G)F EG㼑]Tu ]^ yNJӼEB58bZ+Lb nYo)S 8{JJy}*L&6uL9j.8KGv<"(lزQr=5Əie^.EJ?r1 g+;zMqr[/ij"r)gGCܼc16%VvCEB :LћXٲPTd1DMr0+e$SvVqF!%_Fb$SI%է-13H!MGŮU!5lWa鬋2gP8n -yn00N;WUpګtɏsjT+rK3QZaiY@BHDf/3LQȾY)r '2?.C"uSdWgwͧ &/N.0Jwe:l6]vTȖF=&~u\SƢU& >ًzٴEG.rQnٳtJup1 #w%굌tFr |u~9\8U"+Ln-g#^@㤒"p61N92/&e$ 5Iˆ@㖴٤ q*&SIw&=b4s"eCƅ83xJjb&!9TPMWw?sNq>\vXk{("X 5ELU^P_:1`,[k^sD* 5G.ڼoET)N?3? oaLguAm3S:h~Uķ;>T䤡eiu^nܢf({cY+լaXLe&9RD#Μ4lfKguAm3S:aP[{ ΰ-gX?3? j6ѥ?6_2瞤>eN,VjV?/RXNAjLا5ME V ͫ9:&E"y( ;w eѧ9' u (M@ 1=y9,{TsrF8s3B6kvE!)l .y;ݡV]7Ԭ.dxـq(V5̭!2 8'IHyvOm@^٘Dh!3rT~u߰-dGB  l[d&0knϒsz8DI9Wpbr>0Rכ4[4Q8w+C-ز.@4Mmuebyb-'Zl?Uxғ o6*R1FtʤBF%]1`Ʊ׉urV$A+ (w.-2IsSB^?޶9bg,wVL/ď-#^E7ICsI( b*|q⊱&к=4؛n2k\dc 4Hӝ&nmprGLMU);V`(Bﻀ@E!BogًN"f|$cif,p$[qibXPZA(8T]&*0:)y@DvN5%#TM7Y7N$!v#"$(y }Wצ&VBM#Nn+6VERv+ Iso1iu VFv|_mǶȸw GM>jꪲT<(a")-vh~񗦬RH$&(*fxbHaD]©| ][^xL9j[3P9Fu&E1k@ Q!#9=1i~WLjMGQv-E]BJ3O);np"\Y}m΀X^87_wYfI $q`dKT&EHkY!cQe BuQ1wpxt>AgƂq8Nh|D! ]GU"|rRNpXFQ&H|Fw")W!eZ%&)3FG`n퓭["beZF%+`|Hx985fjԆE2Z} l7bjkݕ,]=>>D(AKpx%Dv̚lxtfYU4]`hDP)GDf̂"n_aNFJL #iaqrlodu0@6`Y5_ {;pf~R$Q%ڀW&AE`̤6A4΢ihJstNJt]{@ޤ1Gxsw:l3'|?Ԧkq>:÷Hz;x{0?GEt~xfv2dL[2&CtA4;yms73?x@x rSN_ Dz߯>!<=C}F4뾑e>B|řR3ITf aγQʷ}2 xT]rkU5MBKgQ߼;Z~_(y2˃XiԫFr<&_QR VH5&BUdͷӎ -:ՆIɶZtˊ"D\:B 2Q cYj݋ [ѓM#vٵnDlղ B!@ӗQWT:¸%'K uIAU?-dG81@D7;\Z(J+uS9c*jPc!JaƬawQmr2l 9SY |$[ty p7(ݫ [Zo\gk0,bi(\#B;:aq S/)p@ bv`;*F)p(54peNN:~ 9>cܲz EEPC-VTz^$MN"n@nՁ"LxD(w\1fb+n(r%eS52=P9HxOr^?R7L=2גDJ $;C\sp.#LPru**FV3,&!To'F(RTQ?\m=*B֋zxgEfhZ>CNmYg')S+fjE]xJO~0X^K!(T q{קr1@Gyh#,Um>r ,S+<_TEZ _(d dTT1ę &^Se7&'ɖ=Ӣoya-ay79FVH,sJةqلrb.~UL4j,$X7ϸw3u@ޤ1GxseF4]b@MB(R2O~PACGx.o_2%8h"¸(7(x10' ǵKrc5$fE cZJA*@n( E 2Xe;8FU2rr;h_V-O(l̢G&b)NCb1LSD S WQ ;t{fOWf눬%VoLT9BBQDS.% HS9L\#υ@(FIG@DVu_,1Ik[hN5HdPذd #Q>L;r'&d b0TβM%LVsQNLT! r& H xwsܹ)ESJ/eT8jE1  *_^wǽZ}7A7.󐐀"'0'F9ĥ(GwٴmS_%åJe|g2@f,&yC{{ x+T[V6W/5A՚6kt5,ҿS#U^.wNm2͂ :rPL0Dv2/=Y漷sg^W"bt<+utW1S/.W)DdH@ qЭE<';PLԙ]6$3OJ'+2d_{{JL(6%49]LA,hO#3RT7ȉ%\;e)ZI's׼o_e+cq XX k8YE 7D5=5VWdGГS XiI1rTEt"bvִnQv? pXӎy޳%M_^+N)ӵWn:QC|]8J`p~cTCR8ڦN11GL!?|;)mtьJ 5&m D@^U7+f*k" n.Ŕk̛b.~35^%!I`I)L!JP8,l30 1X)$S߼)]v. 7PAd$P)O)2x·FD\d]]7J +"P \KfMHl;AmEWH᳖vB,Ȭ1DJbM~\ >3TtD$&TEDEGIٌlkf"SI"(nW?dȿXnz>2%+Ij)uZk̹c|姯ȕtۤܤ[,݊.\%?BՒͣ}0XԱx{Vf nd$"Ѥ22ݮNU×.:8XQeYCEVUC c5},֍S%Eb{>H ;wאR-3>U$($P5;nB"$$gq"雔f Z/kj4rR8h#CrE"uXtId q37c涻9dI&Uf S8zdX<_v\(f/'W:]") .d4< F+:te\9rSÅe]u1UeT00aBӥ IeL. ՑÚɇi6Y\{pL8R1Hm( f W8P3m}CFLdtdcf]e-iS"Ff3PR΢dR5S4f^ }Cx{w=4SQڸ4zR4Q-P}#oY*"rHSvrQLճ7I>aQ6 Tp\7ǒjr6v~HtSS/Mxv]۵tʸr§YÇ ,(c(ʨa1a"#/9,x5o9,?)xԹeZ=ZFDN gէP &Ct3c<@clѧ I PʊT$MFIAnT.(lU5Vg O͕ڶKWࣻn0,4=kv/1eNso1EfҸF;2EVkE\LL`\U1!.WbtHZD܃mDAha%س3nNL" P+2d_{hu~Yԇ붜tAH-$g}"Zi{ %&nZb.w^. z1.)VY8z;`D̢)C2/=sLm ٭UV~VRd97$9&5IW?xM"e2J PQL;j/2g1TRUp-"c˸3kC,.WjņZRN&'-%dəf=8kgm2o&h?(EUUEYCʜ*NqDDDwJ#Ly'`ۚFCLctp ۪ 'efS(c$5CtMvGoUys2jjea+v{B+$5 IUKXF4MW髤RpuHw !UEtHMdVLb%1DwSc!eCүֺSUkɸ`i0A#b M#B{JLf-R؜QlU12iF,װY 8QOwl~8zD? ;PSH.WK%7R&$Y-Ǜș^rɗ+{b_7 d/iKH,2@@錚Ӧ\q䓫~/nYݑ.]*ώf )p2FQ%bӲmPyML6bk;ĕ88m[YHIZI5z67 n1~JtZWuu!)) E"O yLsc>q!|Ø3㞲cb%Y*2hc+o 'KY R\^G$'.`p.W,վ6CpX^87^\3L·kŷ{tȤVndkr1ǨaQK!"X(qtF GJҘ5ANWuEw-ΤBU]MVȘwb^Qr\fIf F6EQ%S9r;'8`5:tNJuݧ(sKc&vt61a`[|t5AaxN @LQ.e)B! !P)@(m4qJ5Ukil |˵Ҟ_T(1vDJ@wN.[nD}Uc{uvɐ*R l0Su,TODD!ڼ<}SMeݨRͧRɰ8;r8p X%2fc9VMR!S1kqq+>sMϲESc ?3+b&UiTYG9UA,i?Bh gYe9SI(EUPR&d("lHNbs銟hxw#E``e4cnHYT7cM8GHFK3[4iaR w4$jER(0u5@ޤ1GxsL[gkJ!+P#H":5}4R- YߗUecp9; `1≡o6p!  jkxΎNWSP]u;!VB:(=و.dOEAYJ3 C+&9}8,bUS'RO+QHVs= MLÓt@&I$YVs,ڮ %!jNMM5Qr5F{ؘ)Ꝿ4ϘB)e!]>" ᡊlLzBDp;lFvPU]Tf~Inzb1`-'c7dh:;uiDER?vR͘ 8bTkQj:OgUM p2!XJ]a2c'^lѵ2\K.GM Րp!EĶP!xPniZ]ҭSef\b-:a0)i1ejD7ȢRT.bNϚuK*E5F]eF!WƱzHQM bcP=!g34RYzz6o2W[zP aQRDSmtNJtұ.*M_2NFCӨC=Yg:\&9es)Py]Ol]T %I2 |Jyf@q$;!9ΒMTWpؗM/Z8s.F:*LWs(ǜ]ƏXDW7||NG|FE\ ]nHbbdR$Bn䛷5mz)qVpmBJ9HK*n_9."#6QMLHA*,Z¦:!|i(gsu)&9圜D% &!9,%vd[3ʚ r1* aUtDnI8Ub:GûLfY:J(nC4l,5!oFfDcIF3iݚ-16{c ߀vО%1YM P+׼uhKɈ%ŸT艹L"f0p$12&&SY`^rKrN'Im2zEKF:As* 8AC;EOu5$bQn6R1Oc߳\E7hD(~ vR;8'Y֬)5XjPp!`b1D7̕\rKz.)GԸiƇ2n );!QSw,SW5b6c1! 2* ¸aձ6,w.">t urr9x,hK9'z. ؝G)UrT(GWrp8Q#]4tƺV{gG"t :c"Vj=E6w4TNa{K0,m K.#s]!s墐*bw1L љW>FE1dbsD..7Ya1󔤜4Y0p^q')Kӯ>!<=Cf,eeuDtdE쓴;Ej *bٛ31ǀY$&PǢlQE)`L/rQ5d٬&Xe~ KB3DQkTVՌy^c4gNY#ɗM=|3H:@6kEUr'e"txDU qݪ ]L`>X% EǑ O&T0*/I"Tw*UAA-_0gEѲ5|,DjZD '))3>3ZtjI]CKق>OnSQ,QLUB.R [\ #T2~e?7~xe.9V):"a[B¡ʭi2[%Fc(&9v|FX/UXV6o2cR:66{:Y b$Cw4jKlÓ['R[&my*uh*4u;~,Qfmq@U0 c@=(ڎCiH aq/טU;HY/PΫe|*N]YꫧA ׎Qh2c(2sfN̬#WY˳I2'qFN 7AR.\eҖLVuașf7.ǫH׊zCMf B"[URX[W)1zeW)q-Y~GL!p2Mb&*4t碉KH%cҾRW/_8$.KHZHBw&x =:3.y!/J*M!dسI#[`&E@tD{j1g4٪NZV$"|edjG S4bݦm4TіiTP)+,ۋ;B:Ar*E_I9(4i!5;r4;kV3mqfn1H!PþP:Aa{W7IWpUW.*9:DMy%!6<_j̴)2Ԝc7n~Ys[|SgLQu-_L%%)(d9"JtcH"`j'4(ɏ}Ӽ 9)ӧ/=wN'Ni,Ȱ(sO: dX0EG@O@1x@q Vxͫd7tR"C")T& ݥ.de2ns9 cʘ=yS>uS~)wl*+EddITMT Q3 Lm?fc)KL2 CS"~Jb |D1M.4^*j˻8r5ME! !ٵ\h2Eଊ[*e yȳ'Yȭ5"bUVdCf8>*k޷݅maʲE,Qp3HEN^״)'ItD*)z41G5 MMګS;.Pw27@'$"z$j8xT Lgh˼ mXqTq"h&upTtǙI~r.o'chFjv,\(Ha 1o!Qk6ݛdMҦ}ܬ #Q6Ts5@v,g`>uWN?`2h:Mڬ21ף\<1Cb`C t]Ejys!eyΠFOK)چ"$&nL Blk/,];85p [寝1&F%zI_6*3 ҍvsV![׫880p-acbXML" B ё%`Ԯkvˁ, ZiE+ K^1/?qs"ݻs(Do"Z-2/SV6sPř~@WeRxE!qşV`5jH֭*;ČRw9aB{a.]AiM[Q]Yj,>l )X/jW4JPbZhPMG8hʰdRdTVY9$-}'W[#VGkQʈ돲&9# a;t"=kg3V)W 3Ep*aOw?%:t@GRӗQg9*j%EnVw\'=&*/a(o;R8# ZYvP)p* `^RQ2ֱrs975DF'wR6g8^!Mx>`eN%fP:SYab>FZ ]6 .#nFcZ\@M&T@(O| WCY$!TԢEHU ]@Q)oS7R̻ȮfcUL;7?FsoIc0]0yyjGN_ DzJ5}1"e%&VR  p,EΚ!a;e5٣ۆ)lr/VN$C̴[D0@L0t@ 艴ThIث'adk!/Y͔2j!xUt727VPw1I3gp+1p͐,(R(!yjl%nvpp$^EC QF+8yyc YH|N8=VrZk-aɲ|\2] (IdT:j@J">!<=CXo[QQn7mn\dNcYه,"uT?7CѦ4keY _`ϊc⦥!e/wǮ4<|sp708[Mp L6Xܶeܐ8!/$vYjA8複)H:I.2ƫQbQ*dLd=YkBH$m~ZKzN T EJ~_GO') X$Qa Ry@(j="t$d"ơZ,T2h"'XmM#(W&d_ j0aG!b, BXٝ3Mrt6 j-v:J&]62g 5J;HaX%x@UoQ ;t{fOU]:^rG]ͣ1x]hŌ4r >IȦ@𘣸ѭO.e9$*gp;R3w5eX *?O< 2Զ^1@"M(gPۂiRHӟ!<хjQٻg[&k4s\MD- DU>WF 㷇6+q`#()IgǗZҎ@EL̒°v!xt`>WF5}"kKz|DqGope7!b1otG+zQUrE4H614tNA &xktxϥY*tm !.rDw5 "U, SR*(UJ̝F9J񅯭9IDؘeHkRE'; SR*^}O[FĮh-d@91ƹ2TH ZFK+]g…Ӽ 9)ӧ/=wN'NwjT} '%EŰdjPudOyjIr :.v,X[2VXX{Xn%d! sViSnܛl܄I0)Rp1iFy?=L-8U'Acm]dv@wMCU5ݫ]Wͭ*ݨcDZvpw rW'-;xF\V%Ȑb ;q)(7䬚JZ:@,N2cdVn]Ȫ]_,zʙHO.;̵DH&&8PC NPvFfjA(<}~06$".7ΎE N^?L_O| WC?3j tNJt]~"*==X=2jX֏%.Q3n ᴭKӶdg]` lSz]1K21!HBAX"&c1P۷MXpUޘL"@e1+m'l"w^o`׀U! 9! 3tD71q 20x.j EP9!ӎ.,3 ]2J)'U投FS3 Use%fRUTL[VF-%p[uNtdIEIFE]k$Ც6qGNwH̟ASşˮtxv1ftBMNR`)$¬"@ 2((^#"*c[fz{I')J$ݚ𘁑ސ&%(0u52Q\]D܎wh}Ĕ7ny~p;89\%#b;=&\,?5ϴj5ǓCK}1gkNEsK/ )r!!`)@0m1pK(UW'8z+YY5gߌtQXL *Hqpm1s ʨ|]Qb,&VI(;88)FOfc1BZFL(ָERIgPX4t )r(J.WMVIg-:.DQY3DIBbNgRê}'yh˿;YHGenu'h`cY:|^||'];`Ӓ:r j#}ߩtNJt]~ct*(.WhnYrV%U**WS^.jk f(sEb@g+ƈ8j^&E>jkzlJsm`7N'O/t &/kqq+ѡO5Ժw?%:t@G]]N*̭hGC R Ʋ!X$&ŨqQ٤aCq݁ƣtiDY:,!2֔v f:#:d;Ik$zpJcVp􃥕ƾ^jm <ȮDcW M|):5@ޤ1Gxs:( ēv8FTEsTjiLA 8i9xH!gdbED@Vb(8wSQ߰wGӏ=G^:u@ӿGMd,]uUӠ (kG3ɛ6jնd/-$Ţ{uRT 1wxwnmY(̽-RT8aAg1Tu1X՞S^6~.?m1աe,v956 rM,L# /H(x,8ʑ]DR[pEXрb+U];./u_88SUELw/^QS# ef"%/o|@77j̔(d^Nشl5h7ψ[$\աLxݴ"Dq2N C9 $9S)!@|=ֵM*䘮DpB%1]cd|q CT?x rSOLIt՗++QG$kYB!.dg $cPp?jntbᑩZCrK2M.lYVM]fu`\% f8>N'Nwj>U t[s N\$s.ݓ+)$2? bSth^*}1d(6 y ("sWSy#ģ vqbBI]X[#sc%~)攔=d1k]xp)p~^?L_O| WC?3j tNJt]~Dh96Xꭲ͞TA "=>Eh~wGIp.+8+(b LyۅWQJۂWS|".UjV]&cLa(mbYR'KpoįNÖjG{Z) ^{1 _N,NPY$r6@QSr7Tan@%L@ s0indਙXf\?S=qՄy2vcfj*)aOVXm6zkK0W#;yEFFlUe"iL j/Q Ĥ$"cdZX҅];tORpMvf'H뤂:  Dzt7]&ٴ̘PZNy6BĵPQr M>F>D"ɱ82_@`V-{_G1%J6h,X;IïAu  %aR* 7j-aIa\{YiݏhOB$՟otCLM>>mU]:^rBU"7\IdER5Y3 LS jK\0o%Wjs?nˊT>ɍfd\ĸ{!tF_}DM߯,a(W ܛӝ7 b4#7ѯ 9jŞ(Nguums*b8L=\ok--C կHU I[ b3f܄a'ZrncTϱy\TiXX1;KA0S ,bUэoHR^/~+,YiǦ{Y6 L 1$еdTnc -MJysK莊Ԯih;vFZq٬{ Q9ٲzR|aH #׬6 NAr h E3΍?THN|S 9YU梏 :unU~5Hc#WN~%('j<X2R =3$_p-"jJICw:zY d\5K\>ě8E/#adȑHƎ9|)Ff:cc*̤:gg7#ғܦ<]t`pn 3raJqÙPh| cH=rӗQMIvmTZΘfY.P1  [!J)QZf !Øػ` ^Vak~Twanp*],ADtHt99D\הc|ufᬕj7NAMbfuٯ00MF茿Hvdm\tr0DVn-.e!O ܂; g a*LS N I0/!M7#t[j5l}abh5x$75+2VSKcKezL>.W +%=&9y)/(.*Dw?N%z433?栺N'NwYanaǓ iw#5}7)n9ci;A"BHQK 7ꨲ(uVYSEUUC UU"uP"c[)&V ;h^5!5- xS4[L ]#fEk MV̐nL/yA0(  #c;\E*NM df4QgqLel%'~&O1H q;j,d^e7H DM):%OKzr3Z*ۍS9ku D)̕} d0c"1ӛuooZ2KW*Giĸ `Y23c@J_o1E>{1 _NuZpc9}.IG' p($c" seXWQE5`o W{ _X-v9$ckg|lzAk-T} S JFY]QQ(`)mJ=ܲ(R!(S'x0iO7)ָ#RXuEn%ﷂ(pB|8JE~1%?`t";Nthvnq#u3I;Gh ,8f9tQ:%;ZƵĉ G 6$9J&=9c!ɕuZDg=1EK;fX61t29TL(ƹ)5 # m)#t f˶.lԅE%-t9QX'e*VjrfMwR2o:,sL"=MV([-gW2HE ]Fcw SH Zf Pk vj9ļ"#f/W99 8@ :pp YjӾGu5R>"_8#G=eP2p!g\D:MBQ mHV`2W`ط`,*6pL0c3+liF5!tȒ 7bgp9d ;̡qḃ["m|wwfnLkeT٦q(Yq'1XU6)4[3{-L .~汓]mT܀E*#]3Ӊ^ y.Ӽ 9)ӧ/=w0bDUDžy`i9ThԲMSaˠG"΃z!v8Ǵa5GҞ;svn͜QAqḽgF!E0Au^65 -ի!bQe ՋR(cC1^ }Cx{w=Ә# #3EnIt)+]Id%*:ݤfjM9XC'Spv~X"9Ǚ2W,C,_BD4rCOتu܅'3DyqY:tIMDE;QqQh\U)vӏ=G^:fH3L ,dFB˳Z>R.A:.1pJp3D7|=-4]%ZcQp:֑"W2DlRm`@8+I(427,27OdvFekpqKP6(b0~ ]Qݶ?]Ut#!z=7;wlksJeZ6~c^2Z9U.{GU3dTrhd L̊x'"ɕW&H2zɇV"XLk1%$&:*"*=䤟X )UT0 զ~X6n8ctWfrL'ݷ1`܁(YN?Utc_w(_ԽקKyɇ?Rbϔh ɗlEOI|w v?y]VveΎP6(9gΣ&!fb=zf3&J&rL !צL-#$4P*Dw`Ikt+\Qw 6pvՠise,w Usإm3W#dkSVnt̛8-{b#Bj#puvK8V˘^\R(˓MڤHtW(1XS~‎4F񷳍mөzm;/SيZz&_jߔ-h%HIù3y4T1SXH E;AM]"w-$E۸n .2k"f)"gUgL6igSz~4vM;Z0BU]9y^@VRSO]rQ?(ܙ `K8V˘^\R(˓MڤHtW(1XS~‎4F񷳍mөzm;/SيZz&_jߔ-h%HIù3y4T1SXH 5 S1C C%1LS`^[Hi#7IYOLa!j9%ƣ!vDҋ*.(RWW5bO6^y!d7K+>02  a0vK"1v|)xTQEOFT$N#B@GeOk1Ҵ\{Sp=\#n/C@vB"r쫞> 9ed!w*#Qf,3r5fɰ%Qfg1J$4SB<S$8 xHۻvk"};iurHDM5L4Ujq9z&9bMD~<9qG4Fu0e2q&\^gfGby.U[A۟KI(U9h"~=GX?U὾ "UJ%b Llor+WN҇쨃NGIT_tzC5k}h((0^'5fXeZ׮J4G-^rAP1آaNQ 3a:Br Q(va缜Q@I7c0lho`90eQ* 4kei7O:{"tzMsW4yjEEh̚ fDSi |1>XVW[*/rinU; Ȁ6 w DƁ^6:ԾS :gs.jߋ$ӂZ$Ě)ɢbS PLU"I¿MSE\hvPY?(l\S \5Udnpq>blr(h$ _jQ/T9LVIHhuЪ9 NԞԊ9P,Tcs<&9`f`paIT~F65A3PN)8MjDD $RILz{bYQϡ#|.Քtt\ Iޮ,b#leSw blT=#5oCqW:jDT)$#=zHS.rcD%q}0w׍hxm&>@1UR`cgcK՝mk$! Pbwz6Vl(: J~04A8|ӬP?,A1 vyb iOQ3H_5<\{*ŰmPWoSuŢn"#?%A֡uT N@dx-ƤgMr\闑U@=QlLMqTEe\sFtJ58}"It`oQ$deBN4F*rON$caiL$c2 WcA&0 MQb3$d;N=iBtƖj}/A]KI"XI"Ls@Gog#}xƁ^6,v8f&H&3^O&lʱj2' ۺI *" uUgS>JeAe,#ٴnQMV-H Ij3ʺeY*VZj &\Qc&̖yeteLĔ1 ~3l7+UD33v 뙌!ZI/eT))}fk,Xڱm"@K3XVfe 19x7 0kEQYUeT04L:(s"#6fCTϔ"M2FZaWV@RѯlQӝVWgyO34 \ǞґW܋WLCq%0aq"fЯsrL4),2 aU[_Ukvڦd[-9,tn3ڸ:)Q)DG˳xئ,#٦al" 7j؉`"#Ry}BVOk1UXnCƌp9L&"J>AқB`|r4ILn]b7"˜@(voŜd{4#"͓TDA&[4LDxJP/ endstream endobj 31 0 obj <> /Length 201449>> stream x[oU/p#"bM(O)0D/OR۪n۱38sJȕ@ .}f6{;t>h$ӱs\nWn~OQ$Zu[U` !IBq6Zu} #fl 'x$.V]R;E7ěٸ5`$I.HpWqmX(VHޫN78w߽Ղ|\> ɫ珎._k }eq `շ3=ѫ<'kLkw7Ėk {DZft1U]%$k s{Tvbo,\.k %̽vb U]9at\[мճ-̋k}.$Lί[4?k(rZ6_=掊k}-$uuãO,:٧o<2Pj=S\?sOP7n=ˎk .L#4k&ݟ?x~^bEax/CD5nŵ׿mbbK|7ǺQuۄ Z? sa鵷''e`ua\/ԣ3LTKq,{?ulJb`EZu3qWqL_[֯9 q8jЃs"joPX)gJqVکp5$ 5 *uӽV}Vu Dzs?6t˵F *wWZ _uttX}»xn%q]fzn?(ݙ?'F1qXu ]ƵZmm(ٔkGf׈NN'k~Y` ~@>BS̳ou7Yu n_.,9y[\O:T]elsqvS3]K ; U;G[\3?5f:Gu:+x.}%pˮYu yFkե!מ'Ư_vugez%qV{zf&MUU V(v,U2(L}ֿ]u9@_J/뿹cO>G:v _]]krd>ZscgS6uļgg̮xz%ztN85ts-+WNU]^2bW8' _tx%0tVuꊳ:_T]baekZ~[o?MlƵJTοoUW,Zb!.zՋ+wP.$CnVp#\?)T\vu "d`GƎ\ եމo7Zzv}>8|\3֠EFǙGݑ_.7(MayDsށ虖?47"~n`ɡl\;>+D7ܑ骫]ts8ӹ5ieJ-%QڸfsqmZ?(]\s^@\,Oەrz0=[jSwjfȗŵkvff9O/0*`{'Vkj]k?>K2B粸6Pv| ?;鉪kӕ>]BzG$q7v#[z;w)=vT]2eޔ}y(ԁ,E[Z5&Δ;F>pLcgvug]Ɇ|S;@v/u1zvwqKehd'"8W+ Lgk}]er;[tɊw$:ZtOk3ŝ"hm0w}\`tT[SOq psH~X\վ!Dz<Ύ|\쾕^q>jǏV|rp+RovR_M.囲m +L𣺵nn:HTKJ4k4bǝ}ؖ?N~ۛ@yGXn4j\vz6޽jgW_?k"_n۶p d~иk.];&W⑾n/Br[\۵`+}Uzw|8|ylG70}!BS;Yk 5,Zj۸Ŷ|qyNQrmٸV( _j~5%S\t%8;[0Ulv}oZCurؾ)mhrH\X7CZ\O]=asL=Y3_h%O3|k^ gESCuj'l` aK.m2t ymbIST?}T[|k2][ĥϔ'@|%J` V[?{jahKv gbb4`\oY*3]-r;<¾l=]BHۢۮ>8ۧBD[;DRJ ?eU <ֵnv~-<,k f2ؿ#֞.kD8sDqaԆ-WB[GdȾHlVԃQ(LȞf5 7{Kk2Z`w 7kKztYp ׌^J8x/ƙS?o)^#;.;wŽ?Lj ?ܫưlK!U>|0dx)2[x(7thd:aâ9dX$WB{~7G C;37K=ؒ˶ rbɯ'CLqGŵ*T]u/}kjb[2Ji9KzgXLhljkQִM;oKD_d{h=hy-mvzb/ mn"ZGN6M=8?.+-ö^#c!dz7j?Gu杲aZ+ʳMhҕ).)vIahMK 56q xeƱOĬuԏLFm<޹r#oL>@8).U.4vdg]=ҿ6wㅐ{O0F\a,Mյ/b63+_ZaQG|O?l+Lظ5S3 MOxdڭ%v[Z6Ҫ[o *pV?Ĭs[\YBdltӭ/5ʟ*l>=~G ycNś|_~mR銪 li;*"4rqX֚ٚ+/xbo\yϦ}?@hk<x>w?-&JZ#t liJ* zYm^~[\۵i#,8pr+kұbkFL5\WWGֆb_cs%l+18\!l>~)sݝk>\jQ(a|iL'>&?utת lqyqτ}Ļ5VL9rۅ,lDwZ}_Pl߫aj֝E_D̕\`8J`{;}"Sk5RZN6ĘO(/k%jg+N(Lfaڑ?ODiú۵u+8w"|l"^'ϒzNrc]?]w>|\+_]}pM>.H*:[kBo<ĵ&6'mVY7yV57uZREұԚsu/܁&}1Jvk6\H)nkB5o;wZ_[D-|d>;j/YhƸ+'k5a\ۮ5ԑrOp_qmSA5FJ?^l+zG{ʯ~4)v!پ֝LO_ZhkȌZlb;;d4Ҟ(/ޜ/;\mG{? Ϧn})䵅GrMANO1-ks%K,va}q%SӳIf[վ7v-0vxَ a$'j*՝2_-+}~AOZL8fkNk}'y5/2Z2qdzaM;#y'oF\ٴuR+;e6gGy-z\ۺf.ߗ:iAcEn62(W &hH'Em1|ZƵ].sO~,0p2'nq7_[:^?iFK]q"-g_[ L,ahwz?*,ٚ;JI2[0 XBcB7kwWoƵW;!fcY!nn7 ;kNj^2q`{?-J)s竢K].u껕hkBd SH?/6=D%bH.'r틅^i^X3/}6e~w++ي6ؒѫݡߕd߷zzXk y#mq,$#'[m{QHK)6 awEs-\Fl, 0P{]l+k!쿝k'- ,`Bx[\#,)7*}ﭰ_JJvwokn2|uWŶ¼* .'ZkCgq V,~)=U׆z0kg JHW:V٧6B2WŖ浮zDhPtׯt[YYܥƧFD xmq|O*{0g"ڹt.-qSA46['?]{jEw%vvw+0>wܥjKTxIkۛJԋlm[+RnOy!Dͮ)C6jOKr+PkAM2??遲Zoĵ@\@!}鲳= ĵLv7_i(:_ |a]H\[eBKms'_eE2u畭`GZLNt8 [ȍWp9!<9i!̕sJk=׆\AEM?џvOU'֏?yX\.y~3ZmI6_ȴC3iz9-sޔyz[ZAtr̽=@RH2s4;:kF~j9wG$;Zj`K)0v\[|Jtavh D_s=|&$3ʷ5l~u^}͇7\̵ŵ% ,[2~,]ZHaLqL#ޛƑdN)Bɐ2E&o"JōOF˯ ;"$RHQ5JUNUȪ hՅ6}ѸxA2܎aSJbxp;wcz5!q|(X w?|~9Cq78d~jW5HQH+AAQ ky&8Rh&N1Kv9Cr욳%~է [CM ;:l5 !|AZ] J_L©F@B |]`pa&%@SX:[2-&VyV#FD n!cBҨn <-s *X4>INjռc,'g?C/S\c;դO\V>7N p]x35vY:A\5"?FВy뼝)^xNqoLi-o7Å:ʝ.Gk\sXeTC=>hlz5'ROտ47k(j?AdX_ r3Ni F'n5<5 ꡭ"= x;ע% :P";(tFLWVj<}N574bKLֺn>Zmf#!wxH\ ]#7tX \S@@͇>fgFa+xUOx[vcST̅UA8gXyEAkx:_2=9vrMHEܮ5i~(d;/ff#!R ѲԈ|@[=ly?cuBc8?he-櫖Kl t,UY- K l%hAg2HD\(hK/SթJy4Yyd}~UV6hvtV{|u\ ܠ!2L쮃bNN\5!4q挳Vh6#Z8Z زǕǓbk+klAw@7*HEXY,1/uVU1"I*PjGh}Ɏ4KL9ʃ}4)I[x0u/*&r0?>\{^]$GrϨOZR+5`K[TQ <бD˜lȾ,/FNrywըa }k Gdg R\SlLtL}+Qɽ]|rr~P2 AL"g/jڗ  b_'9/'\yPx"|zA}`%JqSsViZ/k_4 l~ðCAm/s,b^m{QĶ)gU FB[bỌy8>^`&;$JL?srMߒ-@Sю+ o0u8~-`!n^srt-!׬!ro;b[k\#\0R vsɒ2TZhEt:P"d\V[q)6%90D kqkI4N; H-qMo;O?.i8qkzV "mRPpd!n՚y l%x%~D{{ة:\N.j)]Nq L9$ D `isz \OLz*.e },~eEEVIdD,NqD}U)&rh/Op؃%X(߰Gr ,gkMsT5ufjaKT2\>+@#7 ZRn 5Q3@հϳrM]mU|9t?K`ZA\#<%Xw Wk0ΩV H9ӷo ~=!.A۱gyv8r0َ؆{\]&FÏgd_`]Yzf-GJsbICG GP7И^+kȵٻiy@e$˶m\#C3zw @ tSիΦZrpJ՘+$"Xz'Y5Q[U k'􁘌Zet[\_d%!F4 (-8NK\\l{o6&zXʸBWN}MÙzk`_^'?Frh贃8W4XR+{%UfL9k /'"Th]|}[2L8ɵ F@҃|1$h/+8!hA}`Bk2V U<1\XL$3Y֘ZQ91[p:i]LQ|`D:kpAQ&j/6 㸹n J%5#5B:vaؖLgKrf^TUbbRfs36>n(. )f'93v̙uB;:P bhwrYu߿}jV.p%rB z_ f>\#K;ic3 F;{[ eyۗ>9zM6YR_yS3qzkqf~Xўmq|8r1%A ">h/px{vΫ[GҕoվdhkRm_o1zʜQ>n+ qF{9^R+o`$497@www&÷6g햆|hsmX֓ ֺ;VV{K !݊\2h@5Q% ʵ4Lr&QϖFX{670d4oi] gVKYѣG>6zk* $9JTzNyU`| W  DٮS3q1#X=Frquk·"]Ѷ~[6twfnh/%5AF?v7xVe$0]+_e~A@4$MGM pM ͜Of 3jm1* H3@;\W5T ZĩC-|l?ΓAr d530͵h%W-""Xzwڡ9_GǚhX5ѮvI 271˅>?erb6Dmmr5<1WiIDfuǸ9["z߹8xoQOŋA71ڄ@/j "%~Cr tqtRs ]ՀUnKގw{I8KƓoAa@翿}xm}n785e.$roL94{T/ηToNnA!A3PgO [k`r( {比\lnckP@#iLտK쿦~H ZojTM/i6,IOjqi놵QmI&/w_~7^22Z6kf!yu\m5T<{fqp6+3tk._c5)_isq@w}tU $6U>k1b9<7}v svF[>$` ܂꬜5- "h˸!|b'}kkѡL6xŦ><΍$Kz3E bCrra5 Cvàp@Uf@%A HZ>vyxyN+6-qqڂ6\oeOօjN7{4/ [nhfʏL(؈_U6 e <=.h]0}5܍3`R e_]wVM (uRHa\NB!_J% `JmǖtAEH$Ph]0;([Ķ%c:XJGoLU2y ,ݙCeik& %^7g~zs\(\GoSu"m%&zuOV+= 5%{ԡG8 A}f1c$!P8͡꧱e }6j9grMQ4)MpR9rnMDsAJ_ͯA{=;k|;Z# @r}Ɯ"w&EYg'~\tvOdh b7T̯*c&}94,L0Ϳ̙IM4IVQ:rR͸·k0Qm37is HI&RC\LKAre2Kӑ{e`ܤmlD=P9}4};ҾYr-oN|R3Dɣ { RboʷF} =M8ܮ ]c}zI^U(M.Ar-_k`r_]5f5j^;'~p(܃w'HkEqAMo`yԌܚ{uVn"wks7"!Z7NN$c@O?^=z 4[+X5s<3T+jJWjӏР1@(s #TܑXWY`0 +V-'[,Z R+#":@%riz ~gNչᢎ]4jP ZmcV8VJūwPzXPk RbR ɯP}<`hF3]F)ǵSuL')t"i(+k5kqXTx8ya0ͽ'<_BZkdךӀv-ED\d}opyZ9|nqmW+j5Q|%VOUFc;D") ]S_<7:z0/|MJWcI=H a#\.x>}]Ψ%iG)FzW Kg/wboh233leyE`*C$!HvpOuaOvkW8[oZ?!b. \éb܁qw\}5UEAqJT>ɧ!I^ %x~/ .W1" dUd~O2}hu,V+GܵKm6 \W-{ O;/1A'6Tہ:鵒 4n3^C$!0ưPg.H.wO7 \+P6 a#" ×8V#q(z߰+<,]^=Q[ (1<V|Ő4qTJ@OwkJJTЦ>OH%/,q8ۏv/p6]uпL;5U.=vڟM*(j5kV=XS)(ژ7pĀWޕz(,{$­8*g-q;NXq>^էgv–N ekŵy;faI~$b|vCJ MZ v8&$.(Znb=W 5&PިIlM'7u=h{MۘqD+n>_''aE3S%_x3h>qmLEH Vk9WzM,!I5&wH@@"6^;9 ( Sz ה^Τj;*cKfHOFd~ps>덊\g}W4),!RA ' 7 n=פڕj[f L ;s!kp%!{`\ۨ#呾dW{A41,׮jm'&OmT@GG:8k) $ؚ{n7OEiWǻkA]x2d a$؞`p{ߥϱ^5lJ#G)0v^fltT` r0 <~'}vPD$+Lj ^!T@zjT{0Tz|HG7`@r;H h6|v߫rz$m/vTOzlL59~;]Pn \Zjmŕl 't}1Jk;@=Ysћ^S}H`9i8Yr;drvY$|f;\89b y85):>K&CF.mQ EGfblBܨ aKw!0b]JHظŀPN¨S <(@ukG`;`9ÖZ<"3"kW믹6׬r? `c- aE[ӡh?8b>AHp+tiLԎV05 5$ '6,r}> ZXOc!lǂ y%Uka]HZq݀܃|7D5,ژ`{Hd ?#mJHF-`4ȡ,nak8k[EYéEQ4Öc_[z8̭Qqk 4>9Zbzmc$bt?3A HaFӅk19oOR6 dܯV^S s]n(х[)ݢ'5q@FdUZEe3 wHKgS2z܉u![aWAڭOu{bgVSΪczʢ:`k#FqW${bX(G{"Z$O`ζm+h[Cl%Vc[{mZA2f7:2F$e][0~]i-m.5QQ:.QAǐyyߵ"X[1>NlZ^#7 4SkȬt}ϝbo8 c_>BL7C[X3|H|ˉSarV^#/9XP_% lI{BɩA< Y.L$H &Ծ2]|O^IEBR#( kk!m@~t@ AGVn1DuϾrea -N܊`KYs#5ƘJ-$b ڨ n?0\d>Aexu;p M v55*E^S5O]LN Vmk>K10rM1ûD3XMh5t.JqM|[T1G xi<O{fF_\D3 tY\װ`N-dH}c@k=f0NHm A˵EEd4fsAmHE~GOkZM u5A/jؗr?DE,hӏ{KO`,hSi<^>'خDMP <[xVYʝ\SSxxDW)pW pE,2i kHHkXA psC_'~Q/~o\F6pN=A8 ӑlCq7㠗"#֠H"}^$ҟt Nٍ hS\LGpe LN!𒸇[0N0bcȋDn^M❤ 7_^Tϥ6#`Hk ,06 ~\fzbՂ"z9hS x Z'x-*-c6o6Xq'CqMQ ND^l9`y0`3oABDDr-ר"",Zm4RhH'D{>pKy ^^*sqhA+ >߳ :lu$ m٫n4 '~p5wr ܒ GكyQԀzn5-VD6 (@~ώ`5NgyW ^Ed9Lcy,ĆkToNnume+m AᇗkO t} Q02v*77IcԀPvwMO !VD pL/'bJFsY0^Si$n$C81r3 ˬvR#cx["JDmxӮ5ncnBa|k`c-:!">S\R76`uQ܀")A@Zac4[5_^S 4npkknwp IGATkBkuηzݑl2^'*p^݃cw1Z:0Z9)Ig fD fQ!lmuڰ7p k:k?zgpn C[_dA NK>gP~f0^ScH7zTΛee=/MPX/HbÇmY#DuI[HDڌ p 6V*˗+])x9G1}&?`5l*?v[b)SDyAčfMJkbB`UȠ9PM ϺE~k(Rú `+FDHlc/zDKZ_X}G|`$=,'y MUYL^rx #-KlE(AAYl5$jBG _/&ZC$ZJI(?UUkb4[UKD\۶=Fzoa.ހZ9xey4E Hp ,+pv'}׸AĉAn>Nׁ] ZoU $9\ [dΗ|؎=β"wd.WA -guWb밢-,T64ú~Jc#C},s~LB{v EDJȉTpMfe]t5x ^wCA5-A/2<8mYBnd^߭&a$\k3!p Pͦ4l+:Dss鏃6Yejm9-.>1&_)] $ b Px-t,A47F<|TCʩ-ntKg-jc_ C_ 0*[Iɖ&bjw3GDd \U ?Iu06,j+6:#I<;c_6lB(k3?hGY%~SMs6 \S[-/'3>4^S#LKu`k,?Sb3C+Js+aj*d{@Y wASU|rM9o^SLVn%p=,%' .t>s&*(asEk2&ԜoT(kJɂr*MiuC*95YXfn m60|mS]Q`+،'\ۛ? Dx]א`{&H "Şf:h{c|tf_Vw+{!޿jpvąa,{U $I5J}lcF`j`5Rq>;l=)Έ-Az/uA {)*rMQ2([߿*kC'kiiu{h"!oЭ/נRF9elܗrA<~ X)cl\XYTe$s؄ iܒ jǁZ,Aa>&~k H=!9UյQ]-2#۷YUT7c}lW;ڑ.K1 ( L퉖\Kxi恌 ʘq@tcdzdo)G>4z_.2$tehGrsS N]4F@z$0C|`zm؟ k>A@Ɋoͳ(|1yV%l>& <[mɓ/. 5FsQM o%旲vϯ)J,k7$`ti= ~h>zu>n`^ڒ[b8_uLxٵ+gM xFUUc-(?fIy&Y6QWsrJW$,|{.=.O'%w, 5+h{~bE ?3죞}j`}S 1|0v mSCz,FR)ݾ{qA hMaoljֆ0}菒7G=k7 M{6IyĸS69(0j5z;(^'-jgENÏDžy%>#׬a'` c50ʓ'N7F(OQc͋\s2̜SW&6U7m ME4 b3Yׅ萗v)p#RlX @My_[y{o?!П[+ P$#>`>VrVvFw#vk?0=$ؼ?JdW-&0J6a"K&"tȵ7A# !}m0RZw] M /(5lbD4Mf +P⒞:qh-G҄B*v畎  /b]hPM`wf:6vߊk50-zgt4ׇ%@G(#%myABLJ Z]wAK"K&"l{kXGwmHLtp5Q&:ۮ5ׄo`UyK;E=ixKnȍ ԐRwII7_6|shS>a."TYF"(wtޮ:Lk=nҷCf_D0>-{$ ղ>.@~A;D+ה׸P!W#%3}s6_&]upCш6nfJlRhdMarQےV.`ic7A%ɵ>#n"+e=Cp{ &zoq 6wK gNʴkInvͽ\gr]Z)5(6 RqA \ R䚅^ꌷxDwW@$va81? (7rӰGTɴp&'ZrД.-ES MqAiV@Sup RL;1+4khW8NP9h"D.Uf䝋Feey$,.z?la^`sܔJ[b إDǵÛ.ܭq5hpi{pzeggt]4Y#p6,gdړNUF m9&Jm߭+*з 0 c |bȿY^DUi[` iJ>?4r3-r@941`4}R$ʌ!g" K.|nll8X: SND(k^#E@kD!&$=@ ՔwKtBWCk^i-iT^H;H ]ߎ[\6QK8*zjj $, f[굂V[zђ=$??%Tb:jJ4{JZjN`[ ϛ9@<"YO"58 {?I;sK;$[XNۈ!*Z:Rm#4rxYϮHeț^97+ ;rw ^܊h, ŠdrTa}֑>Jyǟ -V2u`bQ}Z8i9dY@'[1P)NUkTxfn9kkr>䚢$qp,^xCmm.F9DqboK*26m҄tr+A%`(U%_d2lAę6.)es5k:|jύ:&8 B܁5=RI@h^NTR埳"8y&'ؔ/m .J8AN5ޢogFGDYێRMt:BoEBS"zd:MKKk)#$ 6%9kIA\#X˵VZ}lXn"ېҪ Y[x7SkƍǏ1M34JTgo/]ء8ܴвsɂM1y,ɩ7WЮ 4\n~U,stٖH) W[n/1wl,ovP7@ִwy@\YH˨ QHDhnpA&&9AEh[UCRmǺvh"7x)V KpmZx ӷX>6k.ժm bNYoF~:QɃc%MA'7iCt<}[ԧJ9 i 0eW @ zM;#*H35qeSlU4 DaۘBʃ]6z'H'nIR[5gX9 `?r-Gr b3Js5RJH< A9`I;JM[p`Ս&i [:\m8\"Kp[c}ʾ%,צEODx^ ˬP+x z]]f(rv$0]үq CVZ\lŚ mNDl`_)6ƭ|o4-aOk+Cq%0*k޺$Q\YN3.~[8Aa"~c5:i>X#cQ[ù7kA^܍ h44wosR`Ky&ԃ^ }WtMl:mO8ggSL+~8Q]6?0ɛf6HňlYi,[vsrM|],qu\;Br Lprm_Q9(g\e8~ŭoftZGF%ՠhpZ rl ],D%\#_}se$L̔h[kle l5':,ŋ33=nZq1Iŝ7'$ vT`58lJ.Xl>k$"@kwЖ; gP pK*2qsesKv4%̮G޽[[|tWW/Ԙ;%'Jp6<-TrEpw>`r+:`b#"d"ZfZn&ճǙŵwGe_Uk;XƖ˻w,Yp;MYy‚b}Wi4i [-̞=o `LJ+(w,~ L3áشkѴw== .ƥ jOr; ;>7X}̐3=ZԅO 1^]rὨD-2[qac{c` d<+7ZY'/[J$savH?h;=ٗiLF Ϙ/'x^8PV{+{l"[7t@˵ kcJrT!'[ SmFo5[Dbbk //sW涆ffJ]pa yтzFdJ\ \+l l2K."H1.6L :/72KVҒLE2[S,U714\[% ;;fg';ڑ_ 8OHşnZ̈ &wdbKof#_\=1pc""| E RWN`R.gz E68',~u~1-rMUo#5`~Əuh)8O` 0pg0v*R)Ǝ/#Cf3O`'^L:w ^Z S8/l5U`2eѱNj^9ڪ5lMd*~lrvk{>6{Fqoui1|EC$n5`$idADXBv"Ly8='$p~M;L59X9PQ! Hcw.4š>.F7T{.` =*l} ,`''gzMA{[{H+yvWv,߳oQ\#8cp%_gF\j}Lʼn<]+XB "FGSŞQcP`{8ڹRָ^׶)g2B`_ΕN߆@L@2m[Z1p 8:oDma;O/<>ZV*( [j뵃n-rh:SAyny].0lK?9lJP--^k Eíi.|ڌ L97klr G=ES9l}$bѮ4{Za!$_r-pM^-&Y15`rIj+}]qd'X-C5v;{}H>/=>xFHkPdF79e>7z=GAw Յ Ho.Ih'\@Ga=|Qk>HiT7 6[h^kQ2uc&Ǧ,2a MIR555IS92K Z{z5vO+*0{\d.!ö -66_iwD7Q:JFa{Jd^|m;;L?5`nIo7M;3< kHbڈ`qX탁xo |N` X}.pV]#'2T45AC#ZO7ܯha/k0kљ([ƴKq.% FDHrijĆ+V_z NP15MJozI!盵^|dhZ`tupu,BFk~r|kVFp qV@*8coܖ 6AP$ 62~Q𚏑AA= yW$i[\sֆHŚ m;mPe^EmQ)d~k_ItlHDh‘cߝr9 mhN&yBe(b%S`S&tF Zrm!jr'xIrAH`7}* 7 壇 'xW9S1S(n7kO~ӏns~óGQ)(b^}O87A~giSP>\Uq1r9B5Yu.CPH4 s;漬_75ue6`Iמ2k_?j6m"Xrg uV QzMԕĨdG =uzna nKvt HݦJq?c}!8C&\rZۧq2#%{PXZbp6)WzyyyU-.qۏy*l3P_AbUϞ+ zR(n/dݞFKRNKN/Q"X{|^~uD08>Z XEG9vƨ  P30U`!Y\U@v_ZkXL#gzi[| 6w:Ab& Z,!;iPwz\[7G9i\ it٦;ۿ+[nsIH?(Q97Aly>w.E_v`/ڡ:h5OA`1T;Uf2_r %c0$6eFԸ=5s-MBvpyq,j~]qZcnAT^kP@cg圕"/J7l4.b@k@R1oM V?#Z ܂TUL}k- :WcmV 'CE_)msVa 61uo`Z5s\ۙ҅`sBĝAnPEl)4Kev\[[g F 4{\Cw8v7 eyp2sG, 6Gz #`& |<[J*i4-^ݑhBڮ:srRn쉦\czŗ`s5A@DVlS]˸p(؜5Brm.:'ț˚u͋tjS]]9v˗7w$Zcgu.ܽm&_ap[e΍7=T޵f5i-^>FmjUu<u@ALt.Ae[i[;lv? ,ŢuuuM7F-׮ 97ހRa1bծZGV_YT6A K/_>puKue V`tkW˗/_xqO"Xw߃ w]lx˵85okϪ]|}-\ ɳgddp}}ғ*5 =i-Fr e;G/zIkԓ^;踚v<3U^98kg+%ݳNcdfgg_bx$kWq=$Uwp]Xř9FIjmvxռ\vߪ>ܒ_*56GT`g_l r%v%VM3mX]{/ I+|e߈D1#z/wڂ ta$x`PIq<24+D9WOxڕXmW!uVnޅZDT_5V߆- XTpvA]=J!'=vB7%꞉p @끍Tj-u4\Jzξ>pMgL&aINյQJcJl\SF[uFu8C"t.j}\jJ ɭ!U"qfq }xw<ݣLڻʒgCdM3kBq=rfGk ڣnzcŻ6#b$~B4l} up^,?=ѽÉ,|frE-rbX+Lܷ~J4ߣ\CViѣ}D'`ټ}I^)6&u 6^_w⫎\S&4`A`tp?í˕ o/Np'aW%Ck iFfA7U7˵~R rZ~m`[`g6^l1qtS'jy_M5\5!Kmm&J=f-X/S}KS'|>2v,_u%yRYЊ{DlL+3i%g{b&,B+pu~{6l7,YdI$\ d6ҨMm_0ڝ$)IMЖd[5X'y*\U]SnxՍ]<*SdfɈ8q"bL*ڤB2?p0X)$f DDXeP~Π'pK ]<5)v /|\v2qmqn;w#9Mf0.a-%-\Q߹tNi+?&r 3bYb.k2(?w3m"}t_ЂmK=&@%]C zm_@?<?^iЎ }L [7܊BC˵7 I6l7ǻ24_rDt J)$m>6GgRӴf/2!@p~grXh2?hv*ٽ#d !zm5!z&˝2t?mV6p(UeCXMK$DMX8`IXZ[Zs6zLK7Fcl;?<\"IkR!@Hct?8bBk;782ʦHteZŬox"v"9-y+?_ek&'~0m>\.*x3%$8`z~PH^r l/jI.0ZMiQe[fyhƀk n*"FI myi`÷xd LGWS7G/e˧2% ~n״ԧg.תĂӚ!9.vYR4#R: t$嚤o?܏~6{o@+rM1 (L"{H)@~6i3J5*G}g݀q񨀍>bg G_1-(c{Wuզp'} B4d/t[ab)n^dύ6tX^F9gE (J;~~jY@-ZHFF9i *v;sm@Bγpк8MO@' R=]Т֦ktg>]UV![P7[zM5[zbdbi>TW0>ɐd l%.wE 7ʽfLtFDYZ\ĐH}εJ{am$ߪFIVʒ0~B4Ns3 !gI7Rg%qU))cG`Ňi|aiO?r8W֒?ht'w`M-n2P"b`S# HN0t.H*+i i˴\/Fa}2{hpN3W훚vm3Fqc3!EH[ $E)ȮAsrΠ[x<QM*-JM`3۴/Zz3嚪2>]vHvl O_$; z:#rMyo>epW(H" 4t?6<$iNT&D](Z2t5y4Kk|xyȸ8ɊKpk6@jfլ]ӶPG"6wTZUh6h#p/9MrMj YTOǹh)&>Z)IW1cܵbm8wK8`sSk Q⮦ŪMZCQ#Sc[v>*pin7Џ?8ZL|: 嚤.xF|AniPvlgSұ:5vU].QKgc[7^L \ DJQDE$J88$ۏF*bL$ʵx>%DD^OT>İF{h'bVR>\5IC r/rh䚲`>3vqʦؕG9bOx=4-P·f @fʹːmԩSj33NZ̰^H'ݙ@L<ʵ(aO;Ý dM*x6e?Ư~%P6k[sx hZ>yبq>) rAA>0iIR~6P}3*al:&v kO#0h}EM\i43̩V 'O6)O]k#!W& 7آ>I%,]YI\`vњ)f呄 t_IMS{ʹ@߆8~h7O<7S,G #Q]xn1E͛YZ%k0;ToǪy$R Y]s›_2ɪʣu%?%M|k>Kyr5*$t}w"l214tdžSf,JCMnoXA5IXyZš$WmY]rΓ[IK}T|hdu=ر|R!<ahfvJ=.ϠDDSx`QlDιg>7y 6oYGnNgbvp@GsŋO::[&&y+Iyw$`kGRkVq2-rM9f>837n!eeYyD5-P}h--406&7n P`K\S'gه]nm׾y)ZhͲ*JEMmkUV/) ḷ%z\x""]+Y6Ve|tfz-ɫ[H0_Noģ {QY92XgUvestSSgc6DBqkXKx@ Ǥh&irM6o.9bQ['H};ֺ|@;&+MމFô{j!mlFe.;Pƕi* beħv`>VW@rMQȐ5o{qB]Y$\V 6X+ʇV jW>xd59:6k߀҅[j_֯qH5E!=k{3"F/O&X@Jr`JF%U9#ԃJЬOt,cNK&<_#a(*ה쮙YJ諈$[ K5WlD'[ó>l}F.| p Sw!B\"TtDvׄ{K꫈ `4:CVXwkxgrx8wp ]{0J>S=ŇE]L5#rMycZEG?v&1,^h1)bH>K3kvDnq `f|~KMn A0| ׮hxb᭺ሥޱ=M:Fѵ*R*zhN ]{ #r!j rץ70ƩKĐ;EjΛv`zYO;5UŠtPG=ym e'ʝg2^i_)%=;/Zŗ60?V%5GCxuDmĊ6\dN@m 64Y)=K+>pޠ"*,mhyzL |D5!LGN% 3 =ȅAjA >qJ#|i‚kzNM g|e7 =٠X2 v$>j_g[fJj?RrMrp+:,`$pKIcS?O  qUkkt+6}2as$,z菄LOr]̯ 0L:$BcnL5`%F4?߰kݷlW4oq(jI+}H]m:*_+a/֯6N;.of܆mŖa$zy 6.g=v|cJ kSڋ BsDNq~"$FU6R`d!ݿpp5ED^ed4l?]=vк),Vˊ ~mo者᳜rY$ Fv1rw>a?Ia]o[R`Zd*LnRϾҕo"$:5'n[lbky:Us*.EUCѦ]R/4WAjS–T/5O/R̝4nQ;Zf;ǻe?uܼ_$v_$ :OC= { :`EZȉ/ش $UىMʵ:~?6ۣgG^_fI/"i^{ `Ɏl_-xkVl6/V׻䋔G& r_53?[UEe-.~M.] ~WI L*&'~jOrM 6G@l~W?=_/ !h6">"!p'Ed A*KJư \v{#R'+Zf2"ޯG;\dwI$Q/SoZ@]bo4lкlE!5ITk;Jրo^tڭnV6H.פ`sMv,'ߟZ_skߞ´ `NqhۭԪ)j#[59%eol9E%C$|O$k!ZY]IMnLtj)rF5ݷ-(*E>\$~r'O󪎠tY5H&(m}=rؼ*1c"kflwOM''`/ Q.)IDCK?D1' h eC56yAKCv$*0Ykrk⴨;R٢`F[0(S$~'?'*czL+=]It0( $m: 6:0FUۆlMPLS0.8fN=/Zc.$21j_pOmę 6ob$תx'V 0p{\i -T:'*H$4MKlN&X%ת'ƊM=`eJ]H#gSrNxI)ך`jwI@~<7;ByZrPSwl5)؜}@=QX%ܓ}DdRNfPM.si4F5۽j t\WF 6P\V̧XkWdC1v꒞m&qHHωv㕥\sk87y'*e IlV`+ת ^<6hX~|U'OMl`^@yOω90C5gX2ףɫ^EнȵJ՛@fkG?$\(`G#2C^@٤*\i p1ow2O@kM M5i0NkV&Q-L?jOZPrkZ'l3"`z.Y1$QEQsH-}}՝QlxK|r#w-bwBJyn_Fڐ 6#xfl%) 6ԝ&\D8_W}8kI指Uk14 ],6F 6 AUjY}9 JO[)7ɕDWTVW~d9|wRaeBm?fkNq;a> I`z6?O;k%(~«A4"VFd(gyT@HBgBfY%Ism^sLdrkiZyʵʭQWdD<*6 $~W'Im(Kȵ3RՅ:wXcL![`Ϲ4j\ .6kqlxq8(EB.){@8%rI(_20kIͻXӅױO KVʵ 6Z+*{= ^FdZk5p]VJ6ONQSc범k.#cwD6ꥍ?/&b Sb E}ML- ,†AQӽ @ZO5ITT{!Zc^=K%0Tz|zQ=~#|,|lhK,ņ@ .0G-yrM]@]{_E5wqfJb fXٮ^`}d"&Dն.镰aȵ=dOtGކAw0p%|';$Iꀏ.@5U+ؤ^pliR-1 k>O$D>tIIZU$f6lGZoy69fBL]D٫jbkK&ϻLş5 lx 6H&v\\xI:mB U_i`TNg)r[so^^"Il3kY{1EȢ1IJ`Y8412H\VNluN3{P^{($N@] "\s EjSx<~?lXOaJl+3X29*JD!*a0ȶ6lQa-xGl@:|s}mRISKҹ iE[{)׼ 9#h$)[t)ת4Z#qFT 0>os`4l c!DpNІ(xC@^"bIQ(R7yh~B6k/uV3I 0\{"I :C j{˵\RUlJbCueq@ik H1J`)%EF Pn"Z*6j0FuF.WPIR%u\9%@%)׼J~Һ4NLtnM*k\ӇCK8Batݙ$ZQB h}?P+ Nuʕ: +,`|*c"7`8_X&lϩMbV֔J ^mKEowCuy|Wj.`IJ龁lkZ+(;WsL*M %`.WŦ忡@䜔kހX H%ZA|iu= ZOQ QrZiݎP, #׬U -{-<Af0FO:X tCH:8Ԫ)ל"um~- >yC0O;Ӄmu#L#v kz<ޥRku :$(PNVvIGbK9>>{9O*ҖSZlz:%7La𧢇{E,4,K (pQOnːm'#*Gf W4I|; MRnF KbNygb.%ґkEHMeGq׬1|'T8|'oQCwi2eڂ5Thq2:U> $AlH_r.;s+ZZ==ϻta[칟򝼁]FG^!6[v,*#'aFR0~5ʟ^(J,ʶZvnXF>&E;x&2@zfXrI䀾:ws h^dE> !BU07вx["&!ٱoR ?q[ZŤè._^1Z wXLJ Lr-5kV5G ]"BF*HP H@*{.qIJ"N< `\X PbO/T*iA kݶ5bCH-':\{L鯾 h<|r_yh M !e" )V\XtyQ3 'Ǫ[H"I^mkƧ|7;bR~I8FFϾimdlPrH޿`@znv`ڳO(_yMU, 4[~H< S5AΈ6?s\!gb LX_X7OI.M-ym;5=굔y&\ҏ͋FXRjxf`Q#e+N>2Y˵J;PEʃrfc"%a'k^ Mr^I6h Ef?FCCR].(QhGq#@lzlvZu-x́NF IX*m͖5 hBCܠrNxoWy>@ʺH> S gM0/k,pkj_(e~LH&|9gc?mnclxs;߸8?!BlB4 7<lm\D:tHWh=<[u.})Y^ Va 4XE#0'9McņQJ(٢B- )-kX>!6_VlZ,s{@mjI9bQ-zY6Dm)'IjC`8[`=:҈ d uO.c?Sל[)y<0>`.Զk,:\Rpdh,ZIlC|vԬY'hH~`DaV;r}]Vy~c6 ce}4蜲T}%$w}*]\PϫurMaׇhgc4t4/bRGpW>Nd PpU[*n$’4ކX 6;>ȵgfɊ-t$dm.Trm+rmHCn9'(x5}H1ڦuFUwa[DjֳBxJZ5s|kڊ)ohJۻC7eM⍥z!H?;n\{J*hhܝECF[|vcfPX῿+^34YE{HӆРvF_#GxG8\GrLkd+A _Q>Nٴ^._;;<sU>oέUA?K1syNihuH$.ߖ3) <7@k #4 s)E$ph0ZvCDup3q:43u1ϑԠyvl%r jPWSC/WHO*숹Ŋ|sA^;msԷ=' )0k`& Pѱэo$kDO,TB} 6 =gUZZ'['I}]){}Ҕsj(n[gm;6gjCQbD!=8DB n.it,_Uۆ[bɪG1J*pʟwAUZ$UvZ}F~IϨ(=OIˍ\.7nC@}ycgI# #+,>[䵤Ex `C}̫irڷ>IArmMS\m(^+ek^K$Wg I\1b VvKTZVÃn_K(d񖗟Ne,f".ܵ _ QW4fi,3*^#VY5(gc~i_҇#*̤0˚{1ߤ+t+}xHD4%^vhAUfwaHelZV:|;Eőv\~)[UmPuK[M׽V~[|ObA ¬kxJU g Tq7I@אkQBN]h[/烾>^^ sh'%"Bx8’ sdo=^yNn!ql;5:'za/_Ɛt\hm d-J/zYRmz"``*]ņhX>cCDu3#gkn*yL,gqIUlYɵ)zNUچ{gbiϑ 4>3)L]8@աP6ЏsU'|ЪU0U hnfѵjMfdM⌬#,heJz!=~. jKKG{gx/ <8(ձ @&F`{Ȫ: gvwlݬHnʻ6k+Q"תgއX"n!nPNiҵ^tdqlq|!.I#bt=9؍ n K{NLgk_/K\nyNZ5L :$T=S #WUFRCIhka-=77yJ`j1^kEHGurl=P#FE,koGzA(ZH8iKBsJF#H[Jx4`{1;OHEUz,i*qPur_.[jʈÉt]kSViψ{V:p^JhE'ה5' #3/ :ǑH )yAȭ_vV@GZZVf)ؠ/2)k؈lU ;k՘q䩟ufUoE'=D Nb3ZYPyX0*T2A 7@4jY-{ɷ@ y GMs6Buw($F% !kGwp:,$60NuEN=B\D-5do"->޾P. l7rZnͰ/qEf{\]rr݁1Ъzy8MPkKlHFO;~A##غռײ8edi{sF`c\IuEqkWi6Y r-u\V M!H2m١!/X רH܉-9ϧya*frĞ 6QQճ 5RsB=j.`S1X0GY o# lB?_$ .alPUGg(ez.IlEd0Wp sQHBg4bVZ).* 0,ׂ6 HPƗҦuLxFGi^M|Da. x@OA|n f#)+HѬ Tw)+C?b':tPm#]o۽^tMc*5I Ê0iStGrԳYT]3Bu5b!׶r+x'|S^t'xRwa=x{q\EEL%!F6S7`])Z=(Q)}fb N3B Yɵ K(ҿ`nF@b@w+TpE}m~'ȵGylEFF ;a,= :׆rͳ^;x: rRTbPV7g6(,JX"w!v]b@n#KCnΨhi'sXl8Z`ʵ7 {kæ,+'E%vu`[ ]f:v&ja}ޥI]:|I W*G;LiGDon76.|_(9 {& T}7(?z2 @[{c7IXOUBH5w /qR^I/t},`G5IĤVF ͧQo4xlݿ+l0/h5aDkKf? z#޹ XR~sm5[Uwݑ7:Q P B"f !E/zy+Crs#hXiT~>(h=؅WYZp]z^-Cn|450zA~jQG1#l1R s(z$N΢,B<Y4^E*Li_f"L Ԟ>n ]8l1Ȼ45qgdo$y.'E%_(d( gf c<FYzo gL珯:zwivIOyt☛ѩ[֟ к,k3 7\FZg#zF-rqgd2l!b`@\0;;  sy-Z0Zu'9jX1 5h`[ƹHF|54~#?6aϰ̗rMɣ_y%8/[5NUg D46 ⫭WŢQja$Uh"5bYS3[2MŸI;BkZ+fL:8ol=u_Zv8J5A ѬG׺eBo/gQl{z暃*'վ]aת{dZ$&\N:YFHq3Ql`)`96 t}=6},c|{* nuh}O?X˸kը52X8-'T#\S`Z?#xkHvh<: o$<2D*{`:ݞ&F#>=TX`_ƧD-="/ DU:Ic*GaHW-h@3l\ V~8I1^Iq*Z)Bb9B5tc)F=Q),zeQLIHէ k}L GIWU9*!=)hN[AxPY)G$9J/#rUWl5TB.$$ {%k @Ss^?+Cl.>\vu":@,c8^r n00^:"bU9TXr[$"U~1%!`kR0UȤ2&j#n|_Rl`v)jrp _<w-Tj`}EUe1= Ԍ߿d]*~!Cl"h)k /n(D/(D$Zci L&ذ\Ȼ0^[dM:W+L"델-fو }zLSlOW^ d$'\\/X6pZh3re5&kĺuбD?\B#W! \{QIS6Fr- rd}%ZXA[.y\9D:敢-7_{8Ƹsmy/?*E$ \ p\# )0I$TI(`_(FȃlwL l-" (-ÎQ[A5lz_0RrME)0Sf=H$ 'תRrM7 *ƜyR4m(p<iIl7mkr-,1kJ~2Ϟʠ y%fxr Z)'DSrES o8O{V_#1YA*%bl` So٧`V^m1In&ȵj3Ḱ@O)p,|1X#Yj V@]=@ N6)b [Fʨ| ˚JڀPG1%nro ]T>1ȥyKH`W88FpIcvw$g+|hzMWh ѪڿRm*˵0h u݁U*O8pE6-wZFsE%Q'Oyz{^40ຜ-xOfr-t-$ߙ ILF d (KgHUN8k1`>Z<3Yⲉa~ɥ,^rz2ͬ$kH(6̥XSl@" Y?#% ~ک=qVpɾr-v\H1yf o z{PIɣUXʵ W !/*ъ|0`,J]3vV0HebV9}# 赡$|+S0w7A2K؃J^+JjO ;$56iW|u0+Tuuz>w G X^S8*5`nja4kGy!T2r Y2%DF-캴\38޵`R'ֲλPPyLVy \(9Q +Q+<-S@w k%Uߡw'@]3 V!PZͶѷ v;zdҼ%aINPr赐.BC$e5̽ mn$,~["5#Ef zbrùmx!lq"Okr0C`·~UӇ䜨N^] m; H5&.-[j+^{~ ǂ_ڋj`A5e3#*x!$xP+Y yv!Us3_o)#s3B]C9 ܮ0"ͨ}tBIXQ߬s8wZeh@\hlF@TT*elɓkoگ jb[(NaM}&Ɔ<HgUqt/PKWŁ[Z۠:竂LeB O`U2͖rMܘ0Gi7Ca|agL>V"x`iB 7%Y~ȵ`{ }G@k+|L8zAo%(V;l6lBA0k_X[WvqS2(,Jj'ZpL `*~O%*m{iJ`vHջ1Szh[ )B 1TG_0>kVL]$Lwi\l0 Iq95W/qk(DoA/XӚ^ [Mvw%>4J=Y3KU|%[mȁ UZ[Z\{5U&R CԄ侹'uaPj^BJ|a1yۻ.VKCWC`y__NLڼ#]~EJ]KSĉƒD|ɻ0^GuvABʵmD?-%׸L5^hXlK6zMB&U^vv%nT~E L r9'.$<ːbЂMʵ]p, jtY_0sؽtǦ>rݵmA^{򞑤~ zzM}ܧbk3QCo# #6QCYvXí`r 1LyrTۆ]-MNWvdQo~@cm>ySoU6F[% o xZ̖Ђ +!T |PBY@e3A yd:Q*A!F diK Vp=MҗI1k 6)jxA˵`fsImv酴EQh}+D1Vrm8*^Sr#eM*Cwi@M0K4CRTUcktͷ^sFs>)/|m:h1IJ5ՙַa,d0"gyɁr?@>1$l\tHM5[PXCo2AU5vCg!(]xS\Ql7<3E²2ғvm‚mYF)? *^Sr$7A*-Hxkud4aCO OmB7a9V7'A7k5=k;FD+n3(\#./|^ںƥI-]Xl`A(1~mU|)he~,|MrCcC~v7л_6<2YDf,VK75o͜Oկw.D@>_x)J)&`\H5{3 vGNCC5:S$9S|6چG̸ =9YXZ8ǿ1hAEPHI`cv -.lR5fV<2Zՠ8~cjժ'?>'wMyR|Kca Diulu#,ؒn#  VE Kh~(Ұf7 | 6$'4C_U ?o{N\ӟ&K3Z=_̏OG!ϻGFfRՂMOn!]QM땈Azo!5a| !6}wa$B΄TB"<{oZEܨ078MCU `ƋەTPM8>KRO还[~—>g#{$V" _ K*B ˎE8.D$.׬p[\tcV#E-[Mȓ\q`?u=?>)˟?X×IE}c>^u_ Opkdec (T蟄XGy&Fc0qAdcS5<~lPÚ+J-3HQC1\ 5ߦMVjW=(yv8v+%^Zm%d,͝Muqɵ"e γ-%j4Jg%7ARt7pS|58L/S5E"EL{/XݯkGZ2zj+JayawA[D"ɑk5]4f<_mgw_ ׻b(ؠ{ wtج#V?B'O5[c$h;%7a砯~欧Lse _6}YzkjwZTs_׫Z)ն{2mڌF8 uD/h~~J\ۃ"׸Բw)wHB˵Ĥ[{h.h(_-87dz#7 jgkrmΜBOWo5*R <"XG$fgۓl2ncc#\#6%g$TUF~?sIXkч]ז _Y;^ol;JE|# T&\6e@yr6QB%NHC_y'L4^b&^\Kۼp1%2ލx_@^Nedu$x:JYڹ)g~ 4FӟLG&چռ^eP{ DĒWUkuٜ |/!E/mEh@W+66;%Fr8h'$ku*Yb'=f\巛7{exĭH ll *J(;Zx'l 4"q$z V+춼^Jv)x.r*rX.?,r톓JpG2%f<ޜc__2.V+(RI\d2Xbʮa&T "$x}m|"PGjuϹ.r d/7]?+lqTvۯA%TJ< k9R|ʱ;MeDQX-$"&Nxa 3B~F`nslƝR SּT<\J\\k\S_ECK9:} JYWHQ/snRfr2{egxu{$|6L\S}C(2 ]j2j1ˇ,ն7-}q51:WzM13ñ eg(/_ ŜJ<-<6J}ond \Kft[kW&!\^Sʜjqb{.|˽eE磴- 6鵊!ʹEԿYEdž6X)mRqêyg+e)dQҠhk|@q 9Ǣ5WйبT7i*M׆l[Q`saKȑǖHsCir~Rq,\SJrk1`ޱd95S?Z_4w bP9Cɢԉ5h `oGlVaK,o7 [F{.%B3,wVJjH?$m\ߚɻ{pHbӯSR`D4Er6dvO=-a܁F) a)gV@_#GIk FYno*(š#>;͑j"k]\JbMJ]5:S}Yd$)G<8glZDEs-9vg7gSYƧ{_mPC ;iE}lf)s9uS^suu>#s܁6\;{s2{awRȵcB<NY#U(<ۉ/I_naJB5M6ǣ;Cl @RfjfwW9&v57)[Ho#vӒKs3פ`E !הc<x.RNq27岃DRِRF+^^jn(3¸OOg[F-$J4Ge,})f_qOGp{ʌ(cy?!הup*|I>;\595CF٨^^–hy1[56{mi9=`,@l굊yB2^k!/3v`ムr,8'#Xz(ClIxNTF]uX'#l Ä/+5%-SKE $Or)x`kqdkZ. lpX%h&ClIrJAaZ >doG}`"^۴A5)̬'@8> {<Ⱦ9xrKf]s|lϤ` 봷(+ |ڨqz}ƣpȵ)6ɻ`kp 9פk&7 NZhj$锪xrK` 5Vzcai?v2p|q"6\Cܯ#ry a)CZXXr3` d\ˎ b\g"% R@ڇ]ȴ$M, k@yEkdi![o4,]ΉƟuZ6<$ėl#ɛF*:etHG: vp勵Y4@71Fq1;}>܌^IaI,G6% BO`l}`rN4\kRHqܸ?V 3ΏI=Ϝ&)z[n׫kJ$RU<{%WIR -Ђ %vE!;R%w;e>ܭXRFD--İq@Ҁ<z@) 8 øT*P7c lAB:GVe1:I&.,^*(:s z Vm[ǍzetD XKxp,x՟.6op;j<=y %nץ҅Ȩ5/w CV+> *P8NOͲyL+;~s2-PrkVR63Wo gvU|NZ}A3يg,T[[?{Ʋ& !S`ĩrM`sooy/Ū<:u_t:C19Yd5o)교2@Z5U?,0 q?os|VqEطLYߜbv/TCT_h9li}GY]zeدO2 xˑ߿rG]}:Ke[t zoKsQ\Yv^AV@j)齸6aE:n[Ygq1W{&9H^G28pOɪ߶o3`&)^C7٘bFzmnП]z<8tΐٖj$6y8t =WJ# ![7`?>sx#Cōe:Z 9{e3V6H6gj#&\⋥s y2+Ǜ ۰vPPXG= "]c4Y(U@4|M8$ľb'4B﹘R5Z+8vBisRO v)͢OϮ'"<Jc,ʁ2JǛؿVy\A4&z@"Mfa3%)rz5SHe -?o 4\a_0p~ō1Z ..78MGDT&`kqN!@xx/fBw3 jssMǖ+h?>KϤ("N <s3( W tUk/KP|RqJS|CpB ~lPr' Qz=AYXɠ\y) p !v`4 g?_8'}cn1c4N33(7/qlݝ$5"\ALyy~W>l gC0!V8-f*M = ri ~k{<9k`F @-yc %%/ъYW犞|Y5 QsW)!FkzbHi.rt$za,(f)uDŽ{T=?LySs_9"zԑNVyL$>"g-Q%"RS 2/)VJjlVui<Ǧha^61^cy+{*6$4sI]gvqWЯC(UB\Fkr-D}1>闾9jspsigҊ TEOKVurZڑ59z{u2"zb$؜RRaYj lz$qai8YZ2 ȤT(d-ߕBjtc}&Jmnw%_B +@U]GI>&+4# k;hl^BX]#8ZQH3o@)-eulc~ONFIN|WIQ=K66ںaʸC-˥#\VFJ)MrmlΝ J9`8zEp1%u vj H{r.҅_Owv:"R򖜉^~vܗGVh1v`>PLhSKr %7 iƌ4ldqjgvzk.=Ha\,%[k6P6Y33|;$!TsLD` W`;b'Kߑfa1-q W+.'-)A^5ˇ`grat4ۗ7.淺j}=SSxP0Y0jH: ?^"v*rXԼoU`f3%uwI2U:ErM׵ [`sn֚)e3$M6=ey*2NUzNzI8C˸ t[k?` FQE& Q*8,"A"=wPj?azU_>R_B&ኀʝƴOEzxu=mXƅ^4A9~% k#zN=S>\;,ʺg``#5*˦6goq6cn܍`Tk}!ٳlHc!ƊmHrZ8B9iIwlB\AkOɵI.9@E~I͒z(F~ZɊ)m5JTLn{!u=`R*vzFBAibKI>M?.}<t:6;.+T7m1V^^J !֐2A4\Z|Qk8 ?6L g[љ(DQ:wB#G{זG%ffWJ%÷b=N{KE{VW؋$\ zl57>"~1'<`c]z!R ժW[`gzȲڭ!05׸oozs?:fR_yMR3O26kMrw?lehN}&R/`S&|Fɒ>EcdR7ʿQ8H(鵶cz& W`vTHpmv׿ͪ @jY2\e/ӅzB ~ܛ'P 8Ӝ^N!%(#cR5#?IO5p7rB!o[)38Esw@]u6̊r{$T-A[Bz,DI' Oi]ޭOP9L#fqgvb|k޸)%/%sLL &/WC4uX*4gcp5Q"`X$Ộ'ow8pkr-ϝPSs4r;`c?F: N6a%u= ޙ&dY 9Z&t&}82C6;y7)_-ט X29&U@ݠ^YZ5p '7Y]ï`0~HsM#\`=c.R7VIMCSsrh]YPY%`IoPsR/wq,,Ѣ6a݇tC>FnQ-#Ia^ 7FgY9K!(,po[Vo3 /R{QU1AA݂ ~l֗I=cYl%#Ӫ&.ٍVuޜ~vSvMlدRZ+Qs>$D2{);sgx@ ltA.sto Ar2`N g@2:+UCd`%t?<IwQ} R%SjaǗZp&%$z)]mu F$}!,Ed_kR'=pTkVEftPKβ.B_iaJizhcNw if,H:܏$1:?iO܊5/d<|{w5}JQG{DHmCPz$:OsR}K:P,7 &46y6d4KBa?܇-.1P&=G |qmglNnįr^n#[ssYNīxL^Jv J_k҉M~/4A!/.yIBߘ]EhW6+w4k\Zf[V8zhBNR*>Dԉp-BXb߬x&M{' gW;k.ԍ{ԈdH_CRُ]Hf@FΪq&x%ƌ2骘G>7Kw<>kEOU괾DMV;>Ôu6%&}'W=ƣt3gl'K St*i\Z ؁ &yâ+6~zyJ6v+L;ͩL)-ĸzݨWRVe1?L j -|ϡk[hX(C<6ά)x*~Ve{-~̄G m1Ke =犎8k+A<%WŚ}%DBA({CO_cuCtpecr#c+*Pkgo Om  ~lT!dkox 5( H&Oɉ V .~䧞 q5x~)Ͳ9XOH UZH#5 l0Bz B]ڍoƳbl1>0~˅iXKL!M*{mS4REv^G>[@tMgjhu$BQmJݭ8Ƙlyo\UGVkJX5dGSq(<{p¤'mB&(Y^՞ę6|}}̀PϟT2PP6%_;IǤK*yxvw^+d"pZTܪo%Z;ߤd"$ZmԿծn qS(vIlO*ir5Jވ&T?&Sy5R.Kh~Kp&#vQQ5!۝/cL*H~kNW"׫q)Քdޏi}qs1N$=3a˭@=*xUmyy-)=s&{ Emb,(6js$-Ўv.7}+`] mP$>g)gy'* @[r*v ^y)_,mBH`3zaoDũ|ǴqkBhz7C"jV <I̔4i{2/h]LYE"#Y[M+Za,<$3Ew 2فO{O v?;/b-ϖQ-ûE5PU9r2 @OºYی$Cc{Pm2˵P;6Ї(Zp="gfGDΰu[i, (d1ȅWޭJՕ *#(*-WZq i_~mLWx |B} L'gρ\ !6OGrXDH3}-3_V]&/«Je?]6W[3E^VxkEj} 3GJ`:6[kB흆BXD:Pu~[Ƿ2۸k@z_w-u`3Tj:tتjgZU TxKJ͠hXRjVCHܣz?wBMu\7j4g!#sY\R5{pg4h7?T 0nIVhc݇jyZp~D'DvB'I'k>Tm}Չ1 ԇ>?< =$[+&$y_&syhr\z It}pO-L3畦64Bo>)U‡ Z-75vDŽ*N ZJ kb 2N=c^4U?C~2E_VjGA;t מL XhLmquʀ5ŒodPU C,D tBeSmp ^W<D +<´6(MzKX [WYWz4ܿ+8|7ɹ4EGKU@@~#RCrLP~$zuk ku?Zd);&Zms#jj|R$u1tgJ=b\E5.N)e;oc86u10ȵ~k0OؔWhVK3 46vS@ֿZbV3#gN]t:9H.*[xg4G,RG.q\jF$`3?H3Zg?!ZKRKQ4 mLN- C54U~Ek0DMTg폮̓;{rKUVR4Gp0~L;˖*cZ,dKnA BY;SQ41Uӑnp-(~҆c {wa4̏l-9e`@ %}yLTZ9ig5Ex,h_q3ϪsBb~ T&cg&^ƙT`b pdt(|)u#0ʟ>D[8Fҿs.BG [hj$V!-ȴ}SAݞ גV+a ܲj|s,O vaS)tGC aeݙ- x{ً,W;`\4fGPZ;xt}i @Na+[J"wnvoVZO3a7CK^y+_>B @_seM %]L (9d\ҏ=.T!b#BdEʰyf@h6i9/w-Y]Y@lbDsT$[v+kl=<Z("w%0Q1vEi |{ &HlإUJ )- ǿぉ-& %7r ܜ@y i{ZmpԽ VAڟt uCƞN] v,[l YETDʵiloD6&EȿDr F@@Ə+" GڵAv["Ht k'7N=&șv>bpf`U:vYi>ߦYAz^ 04buP\R2kŪCM$1˛{2_lCDE4p xVA)bЬ{QM'NĦ84Mjn9Z:]}. -F7N] ;`HiTB|%B> ?p_{&ٳ`*WׅL!T{S3 ^_\pcQ&p8UO9E6˵b7˸)nMDsӛk,q,غnN@C$tTBb& DgMl{V տi&6@. բ_Dl7|ώiprzp_1uqEix6C7)G K?Qk)usr m~2i]W[pw/q#^q{ϲ FH(بߤ 7C7*]g/&וFZQIЉ"gXԋk p8X*Z&~F) iK E{@k1 "C/l|}$kul@œ;k.=e p6l<ȩe)e JЂ~V*M}IucO; 9f^VȠ>\B]j)jX"Û̦GjCtNiၿJC0/]]^随.z`V+4[j{[MKqȐ)6μ1Fi5X|Cueq'ڊ7Rݱp !c<0˵;"u2]!k΍\Dڃ_9F7QڎnJp49ѻaTJ7v:pgF@NuLlF EzǯN\_Pl 96Ryo|G}ޏPcw} oqߴVs}Qlx=}}\wvȺ\X;y"X}:  b.Ȭ6xe~SFHb.PBB~ ,n*2^96 D얤* ^7Iw QߴUwf?<7&%ɇ_rѫa8} gT' <횂Zhik/7lZ蔓GEuRGJr_cVMHmgЊd5wF!%;vǀ2'Grir⬔cXK NqmZVbkvzdVk̬=yT+~K.9>x[TXңQ˵PA|Yop>(\à5 G"7,u (|m} g;ؠ~ ϏV##FMu7@-Y< G\@c@ V*Y{:#/i&qr O澵;d4VKf8e+G իZ7ե6_ЈJ(){Ga$2*EtMTz0ۨZ<pLP)8//Ƒٖ9Pmg6$ 䅅h4L&3Ѩ \H}~ 氍)&,'6ݰlfVKs3Eb5X*QVyTE [ZDFX!O2_;B.**6;fO`H <)qb󰏑Ry|߾Izݻ[[g.&+H|<*YBn}ޙJxR1#|dK< zT-@Yj 6 kΒi:N7T\#} i^M`Is 냴[LAÙ8׼v95u1F]SL.ʹ=zG')9jΞYM !`Z iMtM_DXÝsܜFq~Pr9Ȯdd]4r Q@Eq/>7Ql0L4(B3[u @VD %Fza*TU݌> 7e/s?jo̠OC $hY`A-$ /,(6]+)&ִkьD}Pވj?UvsgɽCq`qǂ۪㕞Ed"ҫ#n\"z[FN"]ucMn[^Zħi7'\UA4/y5o1@>i RѱY߸kг-4ܫYK:ipzFm,lU R)6ЎdItWxa ~^Ϯi.DPRrIP:ބ^P}3Bl퇃aq GM+D"Y%r믺+;ZHnB\[SkѴ9lL;[_$ג!=طV'QH<@߻787-pgZ\Z^+$.c 9xY;pjYdHAۦݱg^lK jzm.zIoe%sFYD|оvhDT^XEdpKmNC*twe>[FwĎ~@gk[8jlT>*Պi'l6a%"N(ƃ$}J2& ǒ;aSr-f;̐ؕƶ+4d(6FIl&`cy^ vEM)qF8.ຏrO&+Jx&MsRMJU * 67VOsi4 6(pƗ0k(Zp#0;\ʵ5D۾"{jxhGBNEܶ6$]4Xr'y̜$80g|:]FUu Z\[;a־jZu S2ZSGRo~_֚DO(C %^ mɄyO8#bpP 9&Fnlb^ r XցNduM2kY{ 'V,_w&S @![Q bp(Jh/ [,qq{HB5>6\;d|W!~`;]tgǽ"MYDfvK[3!'[!bqu9%oZ5uǼ6qaf5= w$j-.1B#Iou*Zg5?TZC]II^*׸ 6F| NC(xp6~0BV֐_T֤&,G6mЅk;Ng4[5`YRu`6 0$urӶԣT!=&-$\kQ|/<`31<ڠ*}LNicHTk]nE PN#؁>J̞7X7^W5OQH}"!z؛ۏș^TLڑGϛgL5%H\ ٴ1Q}R99?I r ;>TDNjʵb<]FvWM}8lXKwP$+;o/DZOw%k1]SLe*qExDBSتhL޵{0-:AZ]FKMF92BNkmqM$5wGjuS+c 9=);opS.>nGo•7OrB&Db4aKx%Jr-;֨(X(JxDQr?kg~m|e# GR|W !9sVasC82^w-dXe\m__&D΍qyVW$KAcBICġbI( 69GOhY( <(@cOWwK86 *?EcGy5s"c D|0p>x}Mi 3߫[c/}0[ &`9CO%P!'`fM@_3k7}ZٮeH2.3 .kZVv(⣣y!%q4 yc!Vû;@ g'+#:RH(%\70|CBb/g(>k Ll$(7&X rMIE@^|e|TłFnkݖXZQ +y}^@eT6DA꽂T+LWg'O:''x}C"y³ez863ѻ^f:B+%8KD? تR![ub娟7,Vs%v׳ }ccÂmro mtt4[_?7thB+47!`v oIwKd r% 9f32A/_|ZrM+GGŃtE2݊UKBș^VҋH'6FtP<i#XK%6ǨAt{y -h--?aC%VJ=@(B 9]f`ʆ4yvF9cKؠvh@D :&O96ޝR.G^X;bP?H[M}5^N,Iѿmi Ժ'Y-@$F06\pNj;CdZi?#SLܨr^AjsVQrNu׶ BHgд\Pxی H3yJK_Y>w90y[Ʀޑ)rZP\P&מNx(1q`r{SPg׮]Oyf tl^.,_SӖPo 5uww+F6OIw-VqDť ".dlx%D? +27C5iHĪLS+򩂆i%KKo$VsEDd?a'Ti/c*2I U&DۍUZ" qҊֳygY2oО?o^,Ztyl:2ߊA5ϡ)Csm#tx@^$v#`2m+ A/uXDW;=ݔ\ҡ[snZ#wK6$P/2 Ϡp= 6+W_7=5.{`9 }!?iC!V+} n7E731o!yMvқYG^Y3Cxo*nq-(Z@8|3zH[C:G5CT4;{ҸB=rc|aU;T_|"؈_,G~F'le 3%`9FX)y!w.ޤT l\il,j(?lhp t7 8^ŢT 3{] *H꼁MLTCs.'wW<=RvDI"/l /]`S?B5lQ.0eRHx,d{kޘHl|I-fWuv8~WӨo5@a!Eo=蝨VVEqa i]+rO&Ӟ%Mpu9&CQh2k6/Ѥ\N'Qngkg-Pi -;pI ggP:Ajh!TK$f~<^R퐯/y; xνm@b%l[iQ[0H Kס Zg5iH!b ؈ 2wjR PڐФدL޺M1&Wšr׃>@h'g5zxPZni;*Iqr~z6d{?̂!{iŽBH.bO E>EbFP<ϖ7svFd{Ҳp-FyVoyP1iKF6&ƪwq1b73 bXJuċ[j. 37G*2V/,@XC`#qX\8=v6C \'nEo$yG^cEQ:a?#JMfׯ<+fBr T[]=4`YdPCc{ 阱Ќ8x׌mww]!GvaxD~>[Twy2fS3V$b,N4=t{*5jR0z">0jKAGky8O(:ao92D^$Bhu|9Q%Mq@wd+QBǔ`Hm(I{ }X#vvq8p+B rPQR11:Z yIFtުM-[/vdGOVRnlI% d+@9/dAM5K< Ώ'nw]CDL@,&ɵP &fumh: ISk4M;IF8ǼjgP[N Hl#c (/|@am2DLun%D6=;>-~F&__i}"מң|g$@x KZ\ <>ɨdPwl[䳨?!Zvaϡa8$k8M@og6u4$n=鈜'\6AF69.ñ.i 0H)6&CD hb^}Xh_sQm??ͧP>/nj)قrhtYcŽQ\+1-bcwQQp8N&Ɂ Ir\-'TO9SE62>~(϶̡_Zlrov0UjņU[킭@4ǽk\LHɵgNcLN.! 0lƁx9"9AnL4kã+(&ٴp?(^YlAy̬:O&x4Dá MQSΎ׻>~|<8= "6"{tח"v 6؉ƇQ6ޥ J+fϏ(6:Q ^!j7@~1T%rk&x״*jPڂCZrʯ\6KՑe9Lvb|bc)*7`_ cÍ]?~TX3΂Btˬ+ ]?[|zMJd5,[6 <lB쎯9Vlxy ;[P$T؄wt+nƻ/ (] SU/K/RWT!͘XE *%!j A+77=İ1r\Ll*n "}Zf}f@+J[K>4 Av !(ю p;pч}28|[kd+~*E7ʮcWSbw/5Օ˥RnYF>9sHlL"=sdeڣlY: bY41z~P> Z%`6~٣qQM6)ظ1xAI歇TE2T/=FEȩeɈHCM{[>ڷexL,Vfl s)*( %Ox`El1a7t]! gQЧ .o7ЂI'g I4hvhk#_[N#ɴOvrir#WhDzIݟ*/z ۅ}\OJ .>>;7%RPi6'ȯTzPGmz;~`S "k&DkP;s_`#!nٕ8"ZC- lx?ZeΒ|=0D˴LS^fdLӁy6š .d;y Esim3 }=H^5O+J屢F[?wn$ˤRJ/T :" 7@^;gKmtS5lZ3Oc&ƥ+ȴJpA/[MF״L3e捳 tln}r⇻Ļ ٱ庣 Vnav$liFT?[ǎYAhK5ڂKPk,%fGA-:FҨw k?ƔH- X1Noʮ6oͶn6~A)i*lz@Yz:uAK_(}ŧeS J97SnvV6Uy&ֻ6] QTOΖ<#? T!#I.&ǨInGãL$<)Y}+!v]0if|퉈2VλdH ᮄ/ZpR]iKK\ߏ)T&vRiEn<?}dI([B ?jHWFAT$Qg-$ϊRM࠯j AH`~C2&6Qִat,=¬R\G$zD_ƧRn:L/Q2M+qV-]v?Fqp҉H w Ȝ:+Gm#^r6G=tm%vh Nr~/d&zb-5?KW|_[L ##LSaqTёAF:v!'W@v8 ,=lܞ{΂M^Pf/}-xE\CIVʵ]=@b +5_wYh2J:-,^';FF~6/2ÕNR֖fk}T̠S2$p_6NJ1dH4܋6;NN]ɩB@m6d8|MprKɵ[Vq#^KE^HL_$##kleZ$[YTc_LGGbEi0zY?tH:"gk.Qy`;?ZhZ!m&~hXxj'l$hm-LceN+; TT_.DY!N'P_&)4Uk'5s|"tΙ@7[jyse6M됎~$:H!/1TʧJ?lV㥱l*`}QWy\Xlnݓ+W>}f-ͤYUKմYq0 Cs5"]7Ou\eS`gјWl*`l؀%تFٍ`;{QOAHMZV5oF%dԯW`J@ ε&%$AtN@ZPiOr:ljOT5OVN5 6G1w{j2Vӻ tV_|>@6[H >`4>l^*ovvI 'h@rv-p^ B+}3S簧UsڷQ.{Aƈ5nBI)Ů Hr7 'kj4v8=^K{d.. ` l, ^D8s<׉J>e|kRsˍhNs@^Vf_.p15 T߳۠.[6Hڣ:GO#PSLԂz0kkx{(,Y>擵Vss|C9>6N5{{BsҸfb 'gγc~3K+=ə6` x4;9fRhP 6qh5S`'HxtY5&< / 6a-~Y@P1ʵTec.TK\JGPZ)ctAbD3t6gt,MvW6VMwKuNk!`Y PO/XqΌB.MsX.'ʬ݂.L!Y( zwQȵ1=$"9bmU;J{Rpoa]nĶ:ym kpG刚Rl^Q,@6yvb0@;F_~;T$ؘ*ֽA;xC?8}hNSD'\(7A%?>\3np~hLx(*IP|j]`V>/<lCeG*r$ k챒> +ώdP(g+bk民ɥ_`/ ߾WAH?8m2SSe^SPQ\Ndf=36 ۦ' MQ!.7]GYk B]Yl5S\(Oo Q/}X }<*?97;my;㫬 "/f$މkCfSs۴R/q*ZܞA]M97M"-׀ ?rf0CC@DNs3[ui<婨r ̰}uΑ2R1;5e* ˬ-aMvJfSY`QB̧pF{zukko=:э)9Kp)S$Ek/} Hu6}ߨ` < ʲl&\Kzpm22KF@8Xӝ#vv>3mMj:k] F47`Ef,>LlmSĆI;& e`8$Dȡ66} lg[o~ڃg6IJH8~!6Uam9uA$GK=Ad= |{$G"K>7 &ثN@,J!Lv |^!:{BDɔ?eՠ̗[',)?@GD ZMn%=[a7C zW5;6`zlޡ2N?a{:wo3;OJDSݤ31>,VB|YsG䂍=.PRH|va '\i-"r-U&z6X\9CQ$5Ne_rw_)&ssy*_z8yCkƗ+ZHӱs8 p/̞ Wu2(Oj{-<pՠdyYEYWy ~y ԅY DOZ!/52Wz}5|C#{{x 6BÂk]2eL3EiMoV|wQ&?1QSj:x$d +-؋Kjh m z~5Q4(oIT/Igrigı/"2v7` ,QA1órIȵ_.ycT>(Z[h18SRֿ<`I~WՀe\<~I: O14`ڞf h[KZshd.6L \c]4͠@t#vmИI2JrVk}nET w[#lf4s̳ ut1&Y'RKq]Xܒ$K %}ѳU9GE 6UD)/s1&q=xqz;IGuEZuMʲ5Q65$&$a =Vres rFF}pP,{r:@.XܙQHƹ8&}&3v6D*;4_moS㧙m'r$ȵ2z*^kVQT$kaVe:Ti6gߛp~ R:0Q8BH2נ}ˌ:%: 6>z-CIz iwqZA-.^NJCK먽ot [+@|5tťC?(ĂmWT:+>]Co8C`:}V$җ/nޅ~XF%ؘ^ xý7*.|@"k\B Aڱ7.U_n&DU$S*գM@QĂ [ >_Ӳe LaxemM7ΌBH_RMID$ؘ^d 6"܃"By!W*RsT>DA(+I,־D8ƪ` 6 n=V1Bf@e.\g%2B*X!Z.IlNcz- sߨ_HerT"$^wCS  ;rFe9B{w d'~-2 19K}Gwɽ k>p3ʼnrPal"MA]}ϪC wMB'XaQ`N{{L{ǻL$~r hV'x10W6ajP\N4WCg}XOO!78Vo&徻^@ #N+99 {xA/dy9`ˠ3&T)#%ob"؄V\[2Fe1c6ABEVJڥ`mrl1w=Z␢y- ($$CEL;nI`l0ed_X|TnNĦ/⒤?N Zg WH 1mAEsoX.c`%WT xkq=.m$i(X&Z vEP,QntKsD[{x:l'(pXkO\xG|׮kdYc]V$&9B] 'xO8_uRU7+D=DE 5)rdq 4BXs˂5{1V$ʼdx7#5dԟϺ745 [$`~w߯L-1g7\:0<k- \nR~wںCk)G>ػ̈L][L+B-kJdLnyD0܂mgIl[}OkZVYl @0[g\fE=$L&peAkS Do] t.#6|yʔ;l h55lۙ#óz&F$@ѕ2{Zo}r Y@nRiJDϗH/ڐ=x 5Ig<]NZ{\y񎔉ok>=u-#{ a;XQAbyh?6y;Qx5wF0S6fxf[Itҳݲy[ClKRDabuΜlҥI6Իlvuy=; 5vv':I(3H, I< !5y_󏑈[ MrxCȵʒ2h?{&91$PܳU=,2 4<W={;M *7721@U xC(ImI7j[6$y_rY`&oD :7讃|Lŭ%o/r~V}*a"N L4L6&/-ãkVIl˨C$)$q7P)[c <] 6Y>1q{-k$_[7yZE D#%C扟ŝaĸud v7& }ܝt[̊SA lJ1D'AKI$W<+ ׶\+ :Ii")"FRszSWuk_GcDNJ+e'.YderW$+1MqQNkz-tlvKizk|)k.p-&*KR#-|r:>dGcf"ѲXA];bO7mh~+ n1a\( + ָ 1߅~(JAtzYCi0x?US Eݍum]r#¥$Vi\JXei--R J Â!sEq>t07 W/`/B>XtNlhv׆W#|}hXJVףQwc]YG5Zh}:w~<*\x( l9Pe4b fb2Ǖ9{~N< %aau_4$PU,E*QJOX9@I .Nu`Cu^Srm>TRUQ "2hNZ~N!Z L3.yw5|̐%PT!H)i\(LCUo0ne5`ހ +\.@p\tDo՝ Z׹5,FZ{ޏ7t =^H5тvcsKe9nݾՉ;CW@kI55cd[p- DoNsHQs29*LH޵P8,ڇ 6v܈^Ĺ{ |D *6*7 P=yOtN]S} w`x؊6Lr0W.fnjC;g`ZQh r=k]x ־ gVF c"~uPgj]ה\#@+R\[H 4A51>mTnz-ґ簌^TT#\"QTCvLL)(l;8I|Q nM8Q )m`g; Ff̋f~휔 >وR1Nw'xZOi<)m&-p7 \⑝rb-F8(:j1!otqGu-@jo]9݀C\ BwpQXo8z 5q֬k-ZUHB\Gp#&r5~.]IU:U.]bV! Z :Ve\3H"פfsħ< uS+\)/MsNlg?Qt\kH:٩k3btֵŤY:,)s_%R'?W7B]hW@+ځN6P*A&IoBrNk2|H(6~{k5@M$`w#5Pk|;HVr/͚(qϸﱳ25((Nf lT%f|Afw>s37n&qAanDw[#^#z%j8'wb9*([> +%54a!78{ 1 >6?YY>"6lrRp4eo0)7!Z"R u yLkk@͇- E kwBA p:`kh+JI܇\:ϽfL4N.Ѝ5YȠ"IwJѸP=C9=^{oN?ˡ@4dYZiQ#J9QOĘh\/+ 6T'ذ㒯',fpǔ-I"$Q-i. =7iuDQ>OZW|C} H*PLJ^yQsH}BYzdL^5e]s>O{V@^zDL&W-v`7Yz(̑e:$BOw'y!S$ō0vpT]o?co-38Ҝ_~mKDP7a %לHM odxJ`3v x;x6!KX>:2}\ZOy_vC}Փ:6-/V{d{Do  lgogJHDg{/rŞ9#LI($w 9FajRB(t5t[fhυe‚͓+u5 #P =Nr9@%͏Q#*N깈Lwg׽*Gcҗҿ yd$Eႍ ^$|rw9˸j`b E\I!iT"+s\@i "VZclrR! Kű O>L[~5[I iR` qmX5 zW=ʮ|5 ?,aC+yC7 ̠OE67s$6>zd+S?ĝWI!Vmc~Q>@JH!?#3̣3xy8/:9I9a?8"H,n$5~ѫ DQ$Kz;M"3J=%ؾ.k.N",9N%RɤN׼f_Esu߭Ge$ NXi 2YCդ k&XLIzZʀOLlmEkooVMs}@w5>>6v_x[\2 g%לr`YhV0<-":Bd-Vb\ L ]4qC`|+U5x8E.?2im wnix͘FÔ}hO!ʼnmv۵ӶӼ+k.ژĆx#I"֤#ƇAɉKAR5qGg`%'n YuﴐSkꁏi6%ϗR"199:c(H7%o&.[PuoYfZe=*r-IIjLy$iTI[kR>@!aGlmwXEp* l Q0]0na9.Uܷ8ǽ7Vk)G6J3,9 /io5Q(\對O|:+AE+faa_y)c1=9^੐ ƔNK(\Ol-w!ʘ.z 8ϒ`F!ѫA5rU \y+Az J \qL^CpxvBǭ[/ʼ&uX0𭑌˰`':tZLxl֑kX~V[ $X JXD{$˨GLXqk Vbl7nZ@iS?D+ZKF릿9 *86pB\*)I(-\K?FΖ#~;q6Mg=OI=*)#dc O<-`G\W"(3ٍi){貝N2Ym5"?Un2FO6t[A9Ih]L|1ڛ0R&X9܇)$xpaӤ+Mz z—?p& {l7" AG Ǝ*l* Da+>MxMh6" VCfLnrP\rmd):] 61&X4]IJ;[wu@4?E*QF!śb{}=9#`|k蜠}W$e^kaz.J*Y֫He~e(68kIԎpv]&i= !9QF5T ?ib\kC 䚬3&ho ud5ԇ`?ܪ)󢐄tԅ #Vf=&86Ph?B$azޚ Xz.CgqM)$ g<*,9{CaKx曮3 6b?XލNuO #J(GZ<˭* Qx{h^v61!<>RlFeZ3 Qk`r2;NY{}ꆏhKP#;d;9' ,Wj=kZ X4-MmAPWg.W cwOϟ?,bDaM5mY8V2EIjbpX~ǣVڼSv&r%Z ^ω`6+ɊBHM9plW&G`hQhiV5r'bKG\YkHOfSqw3=igp <{Н.Gu'.j$iU|Dp Qx"د=qde~,%d)W r-@E#.Xgdsl-'0?qg lt5THz ;D[gVcklp'0rlgُ2loKgbSPpʰQ1/׃0n%?! ugD uTQj295#sRak&iTǜu[d3ЖwI&`KOHY lSo>m )CI"0*;ɓKb\,Q qkڃx>R`DZV6PEk%|^ӹS +yA\!#t6[9̷,߿ ~}l oG1Z2J@&̦jijxUۡby*{HEsvDFdH^Z Kf/l$J^SA-O4(^^ Y*?\u=zU,-L@5g1mrkjA˒n8/y'QFތ#h'- ~fqtAMr2mJZ=NLEޏ7>0?>3ۏz| 6HB=iiDU&qp:W9gn#E z3adtKc+0N+Bݎ2fwrLbBTO&pgk4ٿ]BHyo>lck.yC^`t;ngye00-v Ɲ7쾟$@frxZ~"ZG`a='Qqb'Tyɑ ](ע|kƕK}NM,k/6!(,P}sx0oḌl5bE%f+rW˛XD|8P$y007NIk`SzM$>ZYc`ƍ鎈Qd \s EY@đ]AOJ6t׈WCvcϺk2\(G,B%VIIYg0x-'[cޖ_d ;Wrw;m=~u^i>Ka{Dou\nrIӎ}< {`LMщZsr-jCK#|?Ȣl|RxB`v#DR BZBۓlū}q$zl_1D! 4Fȅ(-YLvCLَ2H!Mp%`G}vVdm2w]d {n۷o_߫'홈qhx椬ūB6jTnYwLS#Ӵ`P|TC|~:l3 6γçȊFwFz쥠UG5Ib qI3I}0 XolqI .Rv'%!,H 6,eG?"G"خE,:J6p#CRuH6I?ItlcX %hWo)38ab&Ā `#5%~WXz-Nw5Ƃ0ǐm`N:5u2OᇎaLj?;qg)lhOdj!K1sKSؚ,VEY e khL}I&7C vԢ?v}MM"\KNğhI?]q6 lBH~ǽN4RYܓw:" UD݈~ &¬\zcB.D_Ӻ§x %*|r5X;CMk6b;D_I3 X^`c@ ޿?ll7#2YƼ>=g[G vTkǽQH|EYCfQSEYH6;щ+H}%+=s1fD`+QYo7q|ݻ ArkZ< 9xNEGD~!=~U}5'miN2u+W`[FTO 6 {6QfMI^ {i8#M\'gۨ$:ST^SqOd2$?,,.d_עX!<".<2`3ѾA폘3oFLNOT'ƃҨ  Sp.uK.pEd+HS]c&=|5bL&6ʡx`QT wOhL 6NF;ѐM;(2(fMk-94^ d%<4RPܷ8b'b .s 2cC`{g'DB 3Ua, б;wN6QcsSL|Qo =Z-!*;J«_Y©Jn cd?[(:$aN$C-cIn3$H"`VdY@Ă;NJ| 6aDڍlcJ8dմ#NW<őŶ89kRĻqM"E# }Nc8\8;ͧ?;\ZGFaXG d% JAܝnw_i-mk-e=TjSm3"0keU^~p;B *X?lXZzDzͻ`ˠ)8s 裒1_dKeq!a B\+ 6k#,b`OO<<kq,Z(LEMfr~VE4TLrF>lhbMk.,EȵTjzHGbt3`H;Cxr/iFzF:V# :TխpKɻ1 ƦIEX^z|TE54*K8(?_ukZRǁMH'FpC ڎAuU4%$yl,C"BiڱjgA)Xs?[V#VFq 62stlK\0K)B ,Hrgx|`s,b +1@mx!(gU>Uk,@jY]&Ri47kqN1¡4.|2Y j7-XF T:QO#q'-*.ˇPg*^.MH2?~ 31:5`K!D8₼`yy#yB6k(tz-e*pybpK2O*C8`I Vu^ׯG8rMğ8M'u!BF$ P?s'&W ĤeXEܐYRxp8#fK19 t6~lD#O׎pvr/k|獙lCfܟȴGQA~(wK`B5q(ggYlI4_B_OreV7^q9xSٴvc|gF'ҍs%t2j+O7kN !^;(>i{2V)%Cڽ1 Ρx9n߭[W37:"<߅%ylr Ybƕ# #z Ⱦ } 朁.OVd! neݳLģ{\RGwd銯e7$И&9bNa|b(3OI1bJ4%h.rd=H'Wd `*4Wnq?_KR9TtR)s{2Rx6FEr,,kaC-Ad?X ݮ&!fx=Ă"e#{dh*eQS2UgZ+ʅMbЫH-8݈b7wSw{sBp$ר`4Qdk 6b^y >yX ,f(݀* @+˳eq,ʲe {cGe]:mF$,nu8iZXu vI`#`eexf_ܴuWd؁:2U63;McGؠ{l*h۶}үtSe68&ʰƏZljوDj^l.D䚀^GyE*++6PB)$k`S+5:\%^{]1s61;Mv'tqN*2qEFԂ ƐE;lwRʼ"؜ d"ר>[ڒg:ˊʚ 60@s S?Y,x]<c|gM6WlWRZ;tq{\pb`P>F֯r<Ŀ ӫʾX@AC$ZY. ޲>l<́+ ú;PXr?.mQH : =q rWoJ^ kcy%բAFJ Pfa5鸳"^dziIYzѿU@ pE +3ܦj+;|Mfq)3gJVFLۆ>S\FmgܜtkĒ-P.$xι.w:p.ZD@vwIst ekOQr_>wvRDgG9"ѫFw|>gv_u^X6Uj0}+^VdM`2Uj\Y8ke {HGcq*j\*(J.mqܽ~nF, x']-BdkTWni9*D,f 6Wx MiW}eZYgݖ.J~ekSZ2jk)0Wx)I B\{uB.W}jKbXxKƓk%k)($C5Qle;3(#3ö.R_$wk(Ďu5{&[n=x𠳳>+n3 sHe^cfo(Z莾&׮ynJ deZsCǫ kg*hP@&V&GRm^ݹsrplX>1$DZ<$@R$@#Gfޒl>&:5b7\YyqzŚVܶ $kP!ID]9.7Nj.t܉ݾ:Rftbi3Ž ~>\U<=ǚ=MV&Le(Mǔlpal+:Ou,"fzYj1^˳jQqc3Jg3&E[gmh hʾA%G+w<ߩEX{Uy?%Hy Ǔg T$ i+L@=3X9z̩r.NۆTz[1K zNF_N#-!z۬F=ykM j*>rXZȵʊI>?c9EZ0Z>ʙ^mQ2R/OoOף$.T.LHbx;Rf51yTH\'pf?Gf9bE7ɑkWp*3C/??>;'tg3V|DŰ&}Clz\LrJ?&D5I*/GBށ[w▃.}/WLjq2/K_?)ƙDܧ1 \2?%䉢 xE+JKoPkV=߱?_4nkP ץ+{Wu5)y9c~W5l9o؀++}:_Tjqg0ٔdظuh ᵐ ݰ yAf1gQ!p֔(OF*\$TG&=]2QƓ]6zlYB/5GJ;J W4[3 "Zb q]8:߿Ujfm=oCR43wł5=B=`=AgJ/GZMUcVCdlZE;TllDq"~#D uOݬIP!Pr/  jÃAqowOh4ŝ3E4_M=0x w.LHP)rmlG\`Qz=Xux@^ R'~#//wbmD։$)Ehܑ4VK9x3(g)+܁D41n2~5upL}ȼZ8rڼJ"Y[@( 1]dhKϮG\SbNԴҼ+IEf-T57OʫU coȵ1ȱ' %B*Htrlk[VBQ]NeWllPT-45QE[Y~ñU=\u:m;gxͩ&1d4r-eb疰curKV>`@Zec2?;Ww 赲YV~|F!j_㯭 TޞLAʾ9DSUĈyoY[~g3wAuS_MDʵJ_W-)df>nGH\U&ekQg*G;$NKUC{) tD|(;dLjCW\'b|燴(H}S_*kX]*l,h4\GmO- on$'~eϦ`#EZ$P֋R0w5ktqͧ^;FMc#+?^vjaKcxE/]芽 }zLLVpVQ̮K#ONm`Zn$Fxg,"Z訌؉a d%ߗ:Џ˱m=*f*l[EW 5܎^Ę`k)ΏRkG^ OSj0Va>TM~^U,7\xTh" =2r];_LIf=hA`K䱶?)40_҄n :,R֋jARwDa] ,fGFޗJ+;>5G.2{!4[WЖ뵪bЮv^t@*`Gb3/lzk( t` Z=gjVAkZtŤ-㳞 aVk)HmŒdA%eDZ1zdqM6o(Ĵ:U 1^ `(~yqKi?Ϯ X l0j6svA++Z3ɰtV$+)